Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA128355.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA128355.1, 426 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|1688405|gb|AA128355.1|AA128355 zl24c05.s1 Soares_pregnant_uterus_NbHPU Homo sapiens cDNA clone IMAGE:502856 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

1-304  (8-312)   99% <-
305-426  (17255-17374)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 ATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCCAGGACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      8 ATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCCAGGACC

     50     .    :    .    :    .    :    .    :    .    :
     51 ATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGTTTACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     58 ATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGTTTACT

    100     .    :    .    :    .    :    .    :    .    :
    101 TGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAAACTTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    108 TGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAAACTTA

    150     .    :    .    :    .    :    .    :    .    :
    151 TTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAG AAAG
        |||||||||||||||||||||||||||||||||||||||||||||-||||
    158 TTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAGCAAAG

    200     .    :    .    :    .    :    .    :    .    :
    200 GATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTCCTACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    208 GATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTCCTACA

    250     .    :    .    :    .    :    .    :    .    :
    250 TCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAATGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    258 TCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAATGT

    300     .    :    .    :    .    :    .    :    .    :
    300 ACTTC         CTTCTGGGTCTTGGGCATGTCGGTGTGGCGCTGGGG
        |||||<<<...<<<||||||||||||||||||||||||||||||||-|||
    308 ACTTCCTA...TACCTTCTGGGTCTTGGGCATGTCGGTGTGGCGCT GGG

    350     .    :    .    :    .    :    .    :    .    :
    341 CACGGACAGAGCGGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAATACAT
        |||||||||||||-||||||||||||||||||||||||||||||||||||
  17290 CACGGACAGAGCG AGCTGACTTGGCAGGCTTGAGGGGTGCGCAATACAT

    400     .    :    .    :    .    :    .
    391 CTCCAGCCTCCTTAGATCACAGCTCCGGAAGCAGCA
        ||||||||||||||||||||||||||||||||||||
  17339 CTCCAGCCTCCTTAGATCACAGCTCCGGAAGCAGCA

END