Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA156944.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA156944.1, 421 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|1728559|gb|AA156944.1|AA156944 zl19e01.s1 Soares_pregnant_uterus_NbHPU Homo sapiens cDNA clone IMAGE:502392 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

1-305  (8-312)   100% <-
306-421  (17255-17369)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 ATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCCAGGACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      8 ATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCCAGGACC

     50     .    :    .    :    .    :    .    :    .    :
     51 ATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGTTTACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     58 ATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGTTTACT

    100     .    :    .    :    .    :    .    :    .    :
    101 TGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAAACTTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    108 TGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAAACTTA

    150     .    :    .    :    .    :    .    :    .    :
    151 TTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAGCAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    158 TTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAGCAAAG

    200     .    :    .    :    .    :    .    :    .    :
    201 GATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTCCTACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    208 GATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTCCTACA

    250     .    :    .    :    .    :    .    :    .    :
    251 TCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAATGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    258 TCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAATGT

    300     .    :    .    :    .    :    .    :    .    :
    301 ACTTC         CTTCTGGGTCTTGGGCATGTCGGTGTGGCGCTGGGC
        |||||<<<...<<<||||||||||||||||||||||||||||||||||||
    308 ACTTCCTA...TACCTTCTGGGTCTTGGGCATGTCGGTGTGGCGCTGGGC

    350     .    :    .    :    .    :    .    :    .    :
    342 ACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAATACATCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17291 ACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAATACATCT

    400     .    :    .    :    .    :
    392 CCAGCCTCCTTAGATCACAGGCTCCGGAAG
        ||||||||||||||||||||-|||||||||
  17341 CCAGCCTCCTTAGATCACAG CTCCGGAAG

END