Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA225219.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA225219.1, 253 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|1846527|gb|AA225219.1|AA225219 nc22a09.r1 NCI_CGAP_Pr1 Homo sapiens cDNA clone IMAGE:1008856 similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

(complement)

1-124  (60915-61038)   100% ->
125-253  (77981-78109)   93%

      0     .    :    .    :    .    :    .    :    .    :
      1 TGAGTGCTGCTTCCGGAGCTGTGATCTAAGGAGGCTGGAGATGTATTGCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  60915 TGAGTGCTGCTTCCGGAGCTGTGATCTAAGGAGGCTGGAGATGTATTGCG

     50     .    :    .    :    .    :    .    :    .    :
     51 CACCCCTCAAGCCTGCCAAGTCAGCTCGCTCTGTCCGTGCCCAGCGCCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  60965 CACCCCTCAAGCCTGCCAAGTCAGCTCGCTCTGTCCGTGCCCAGCGCCAC

    100     .    :    .    :    .    :    .    :    .    :
    101 ACCGACATGCCCAAGACCCAGAAG         GAAGTACATTTGAAGAA
        ||||||||||||||||||||||||>>>...>>>|||||||||||||||||
  61015 ACCGACATGCCCAAGACCCAGAAGGTA...TAGGAAGTACATTTGAAGAA

    150     .    :    .    :    .    :    .    :    .    :
    142 CGCAAGTAGAGGGAGTGCAGGAAACAAGAACTACAGGATGTAGGAAGANC
        |||||||||||||||||||||||||||||||||||||||||||||||| |
  77998 CGCAAGTAGAGGGAGTGCAGGAAACAAGAACTACAGGATGTAGGAAGACC

    200     .    :    .    :    .    :    .    :    .    :
    192 CTCCTGAGGAGTGAAGAGTNACATNNCACCGGA GATTCCTTTGCNCTGC
        ||||||||||||||||||| ||||  ||||| |-||-|||||||| ||||
  78048 CTCCTGAGGAGTGAAGAGTGACATGCCACCGCAGGA TCCTTTGCTCTGC

    250     .    :
    241 ACGAGTTACCTGT
        |||||||||||||
  78097 ACGAGTTACCTGT

END