Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA229172.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA229172.1, 366 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|1851024|gb|AA229172.1|AA229172 nc45g08.s1 NCI_CGAP_Pr3 Homo sapiens cDNA clone IMAGE:1011134 similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);contains element MER29 repetitive element ;, mRNA sequence
>ENSG00000017427

1-15  (24951-24965)   100% ==
231-254  (51045-51068)   83% ==
320-366  (53968-54013)   97%

      0     .    :    .
      1 TTTTTTCTTTTTTTT
        |||||||||||||||
  24951 TTTTTTCTTTTTTTT

      0     .    :    .    :
    231 GCTTTTTGTTTGTTTGTTTGTTTT
        ||||    ||||||||||||||||
  51045 GCTTGGCATTTGTTTGTTTGTTTT

      0     .    :    .    :    .    :    .    :    .
    320 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
        ||||||||||||||||||||||||||||||||||||||||||||||-
  53968 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT 

END