Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA305061.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA305061.1, 554 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|1957409|gb|AA305061.1|AA305061 EST176084 Colon carcinoma (Caco-2) cell line II Homo sapiens cDNA 5' end similar to similar to cystic fibrosis transmembrane conductance regulator, mRNA sequence
>ENSG00000001626

1-554  (187310-187863)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGACACTGATATGGGTCTTGATAAATGGCTTCCTGGCAATAGTCAAATTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187310 GGACACTGATATGGGTCTTGATAAATGGCTTCCTGGCAATAGTCAAATTG

     50     .    :    .    :    .    :    .    :    .    :
     51 TGTGAAAGGTACTTCAAATCCTTGAAGATTTACCACTTGTGTTTTGCAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187360 TGTGAAAGGTACTTCAAATCCTTGAAGATTTACCACTTGTGTTTTGCAAG

    100     .    :    .    :    .    :    .    :    .    :
    101 CCAGATTTTNCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGC
        ||||||||| ||||||||||||||||||||||||||||||||||||||||
 187410 CCAGATTTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGC

    150     .    :    .    :    .    :    .    :    .    :
    151 TCTAAATGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187460 TCTAAATGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCG

    200     .    :    .    :    .    :    .    :    .    :
    201 TTAATTTGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTTATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187510 TTAATTTGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTTATG

    250     .    :    .    :    .    :    .    :    .    :
    251 ATTAAGTAATGATAACTGGAAACTTCAGCGGTTTATATAAGCTTGTATTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187560 ATTAAGTAATGATAACTGGAAACTTCAGCGGTTTATATAAGCTTGTATTC

    300     .    :    .    :    .    :    .    :    .    :
    301 CTTTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATTGTTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187610 CTTTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATTGTTTG

    350     .    :    .    :    .    :    .    :    .    :
    351 CTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATACCACAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187660 CTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATACCACAGG

    400     .    :    .    :    .    :    .    :    .    :
    401 AACCACAAGACTGCACATCAAAATATGCCCCATTCAACATCTAGTGAGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187710 AACCACAAGACTGCACATCAAAATATGCCCCATTCAACATCTAGTGAGCA

    450     .    :    .    :    .    :    .    :    .    :
    451 GTCAGGAAAGAGAACTTCCAGATCCTGGAAATCAGGGTTAGTATTGTCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187760 GTCAGGAAAGAGAACTTCCAGATCCTGGAAATCAGGGTTAGTATTGTCCA

    500     .    :    .    :    .    :    .    :    .    :
    501 GGTCTACCAAAAATCTCAATATTTCAGATAATCACAATACATCCCTTACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187810 GGTCTACCAAAAATCTCAATATTTCAGATAATCACAATACATCCCTTACC

    550 
    551 TGGG
        ||||
 187860 TGGG

END