Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA456321.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA456321.1, 507 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|2179531|gb|AA456321.1|AA456321 aa13h06.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:813179 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

185-494  (1-312)   99%

      0     .    :    .    :    .    :    .    :    .    :
    185 CTTTTCTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 CTTTTCTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTC

     50     .    :    .    :    .    :    .    :    .    :
    235 CAGGACCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 CAGGACCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAAT

    100     .    :    .    :    .    :    .    :    .    :
    285 GTTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 GTTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATC

    150     .    :    .    :    .    :    .    :    .    :
    335 AAACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    151 AAACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAG

    200     .    :    .    :    .    :    .    :    .    :
    385 AGCAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 AGCAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCT

    250     .    :    .    :    .    :    .    :    .    :
    435 TCCTACATCCTGTAGTTCTTGTTTCCTGCACTCC TCTACTTGCGTTCTT
        ||||||||||||||||||||||||||||||||||-|||||||||||||||
    251 TCCTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTT

    300     .    :
    484 CAA TGTACTTC
        |||-||||||||
    301 CAAATGTACTTC

END