Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA456717.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA456717.1, 482 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|2179293|gb|AA456717.1|AA456717 aa13h06.r1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:813179 5' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

(complement)

1-170  (60869-61038)   99% ->
171-474  (77981-78283)   96%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGTATGCCTCCAGCAGTCGGAGGGCGCCTCAGACAGGCATCGTGGATGAG
        |||||| |||||||||||||||||||||||||||||||||||||||||||
  60869 GGTATGGCTCCAGCAGTCGGAGGGCGCCTCAGACAGGCATCGTGGATGAG

     50     .    :    .    :    .    :    .    :    .    :
     51 TGCTGCTTCCGGAGCTGTGATCTAAGGAGGCTGGAGATGTATTGCGCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  60919 TGCTGCTTCCGGAGCTGTGATCTAAGGAGGCTGGAGATGTATTGCGCACC

    100     .    :    .    :    .    :    .    :    .    :
    101 CCTCAAGCCTGCCAAGTCAGCTCGCTCTGTCCGTGCCCAGCGCCACACCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  60969 CCTCAAGCCTGCCAAGTCAGCTCGCTCTGTCCGTGCCCAGCGCCACACCG

    150     .    :    .    :    .    :    .    :    .    :
    151 ACATGCCCAAGACCCAGAAG         GAAGTACATTTGAAGAACGCA
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
  61019 ACATGCCCAAGACCCAGAAGGTA...TAGGAAGTACATTTGAAGAACGCA

    200     .    :    .    :    .    :    .    :    .    :
    192 AGTAGAGGGAGTGCAGGAAACAAGAACTACAGGATGTAGGAAGACCCTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78002 AGTAGAGGGAGTGCAGGAAACAAGAACTACAGGATGTAGGAAGACCCTCC

    250     .    :    .    :    .    :    .    :    .    :
    242 TGAGGAGTGAAGAGTGACATGCCACCGCAGGATCCTTTGCTCTGCACGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78052 TGAGGAGTGAAGAGTGACATGCCACCGCAGGATCCTTTGCTCTGCACGAG

    300     .    :    .    :    .    :    .    :    .    :
    292 TTACCTGTTAAACTTTGGAACACCTACCAAAAAATAAGTTTGATAACATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78102 TTACCTGTTAAACTTTGGAACACCTACCAAAAAATAAGTTTGATAACATT

    350     .    :    .    :    .    :    .    :    .    :
    342 TAAAAGATGGGCGTTTCCCCCAATGAAATACACAAGGTAACATTCCAACA
        ||||||||||||||||||||||||||||||||||||  ||||||||||||
  78152 TAAAAGATGGGCGTTTCCCCCAATGAAATACACAAGTAAACATTCCAACA

    400     .    :    .    :    .    :    .    :    .    :
    392 TTGTCTTTAGGAGTGATTTGCACCTTGCAAAAATGGTTCCTGAATTTGGT
        |||||||||||||||||||||||||||||||||||||-|||| | |||||
  78202 TTGTCTTTAGGAGTGATTTGCACCTTGCAAAAATGGT CCTGGAGTTGGT

    450     .    :    .    :    .    :
    442 AGATTGCCGTTGATC TTTAACCATAATGGTTCT
        ||||||| |||||||-|||| | ||||||-||||
  78251 AGATTGCTGTTGATCTTTTATCAATAATG TTCT

END