Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA542914.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA542914.1, 498 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|2291394|gb|AA542914.1|AA542914 ni98c10.s1 NCI_CGAP_Pr21 Homo sapiens cDNA clone IMAGE:984882 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

1-218  (94-312)   99% <-
219-410  (17255-17450)   96% ->
411-498  (73400-73486)   93%

      0     .    :    .    :    .    :    .    :    .    :
      1 TTG AATGTTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAA
        |||-||||||||||||||||||||||||||||||||||||||||||||||
     94 TTGGAATGTTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAA

     50     .    :    .    :    .    :    .    :    .    :
     50 TGTTATCAAACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    144 TGTTATCAAACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACT

    100     .    :    .    :    .    :    .    :    .    :
    100 CGTGCAGAGCAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    194 CGTGCAGAGCAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGG

    150     .    :    .    :    .    :    .    :    .    :
    150 AGGGTCTTCCTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    244 AGGGTCTTCCTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTG

    200     .    :    .    :    .    :    .    :    .    :
    200 CGTTCTTCAAATGTACTTC         CTTCTGGGTCTTGGGCATGTCG
        |||||||||||||||||||<<<...<<<||||||||||||||||||||||
    294 CGTTCTTCAAATGTACTTCCTA...TACCTTCTGGGTCTTGGGCATGTCG

    250     .    :    .    :    .    :    .    :    .    :
    241 GTGTGGCGCTGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17277 GTGTGGCGCTGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGG

    300     .    :    .    :    .    :    .    :    .    :
    291 TGCGCAATACATCTCCAGCCTCCTTAGATCACAGCTCCGGAAGCAGCACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17327 TGCGCAATACATCTCCAGCCTCCTTAGATCACAGCTCCGGAAGCAGCACT

    350     .    :    .    :    .    :    .    :    .    :
    341 CATCCACGATGCCTGTCTGAGGCGCCCTCCGACTGCTGGAGCCATACCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17377 CATCCACGATGCCTGTCTGAGGCGCCCTCCGACTGCTGGAGCCATACCCT

    400     .    :    .    :    .    :    .    :    .    :
    391 GTGGGCTTGT TG A AA T AAAG         CCCCTGTCTCCACACA
        ||||||||||-||-|-||-|-|||->>>...>>>||||||||||||||||
  17427 GTGGGCTTGTCTGCACAAATCAAA CAG...AAGCCCCTGTCTCCACACA

    450     .    :    .    :    .    :    .    :    .    :
    427 CGAACTGAAGAGCATCCACCAGCTCAAGCCCCGCA AAAGTTCTCCGGTC
        ||||||||||||||||||||||||||-||||||||-|  |-|||||||||
  73416 CGAACTGAAGAGCATCCACCAGCTCA GCCCCGCAGAGCG TCTCCGGTC

    500     .    :    .    :
    476 CAGCCGTGGCAAAGCTGGTGAAG
        ||||||||||| |||||||||||
  73464 CAGCCGTGGCAGAGCTGGTGAAG

END