Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA574301.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA574301.1, 420 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|2348816|gb|AA574301.1|AA574301 nf45c04.s1 NCI_CGAP_Pr2 Homo sapiens cDNA clone IMAGE:916710 similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

(complement)

63-123  (24266-24326)   88%

      0     .    :    .    :    .    :    .    :    .    :
     63 CTACAT ACAC AGACACACACACACACACACACACACACACACACACAC
        ||| ||-| ||-| ||||||||||||||||||||||||||||||||||||
  24266 CTAGATTAGACAATACACACACACACACACACACACACACACACACACAC

     50     .    :
    111 ACACACATTCACC
        |||||||--||||
  24316 ACACACA  CACC

END