Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA574374.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA574374.1, 357 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|2348889|gb|AA574374.1|AA574374 nf46c04.s1 NCI_CGAP_Pr2 Homo sapiens cDNA clone IMAGE:916806 similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

(complement)

12-64  (24275-24324)   92% ==
124-147  (27225-27248)   83%

      0     .    :    .    :    .    :    .    :    .    :
     12 ACATACACAGACACACACACACACACACACACACACACACACACACACAC
        |||-| ||--||||||||||||||||||||||||||||||||||||||||
  24275 ACA ATAC  ACACACACACACACACACACACACACACACACACACACAC

     50 
     62 ACA
        |||
  24322 ACA

      0     .    :    .    :
    124 AAAACAAACAAACAAACAAAAAGC
        ||||||||||||||||    ||||
  27225 AAAACAAACAAACAAATGCCAAGC

END