Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA578948.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA578948.1, 430 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|2357132|gb|AA578948.1|AA578948 nf34b11.s1 NCI_CGAP_Pr1 Homo sapiens cDNA clone IMAGE:915645 similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

5-314  (2-312)   99% <-
315-430  (17255-17372)   93%

      0     .    :    .    :    .    :    .    :    .    :
      5 TTTTCTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      2 TTTTCTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCC

     50     .    :    .    :    .    :    .    :    .    :
     55 AGGACCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     52 AGGACCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATG

    100     .    :    .    :    .    :    .    :    .    :
    105 TTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTCATCA
        ||||||||||||||||||||||||||||||||||||||||||||| ||||
    102 TTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCA

    150     .    :    .    :    .    :    .    :    .    :
    155 AACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    152 AACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGA

    200     .    :    .    :    .    :    .    :    .    :
    205  CAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTT
        -|||||||||||||||||||||||||||||||||||||||||||||||||
    202 GCAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTT

    250     .    :    .    :    .    :    .    :    .    :
    254 CCTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    252 CCTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTC

    300     .    :    .    :    .    :    .    :    .    :
    304 AAATGTACTTC         CTTCTGGGTCTTGGGCATGTCGGTGTGGCG
        |||||||||||<<<...<<<||||||||||||||||||||||||||||||
    302 AAATGTACTTCCTA...TACCTTCTGGGTCTTGGGCATGTCGGTGTGGCG

    350     .    :    .    :    .    :    .    :    .    :
    345 CTGGGCACGGACAGAGCGAACTGACTTGGCAAGCTTGAGGGGTGCGCA T
        ||||||||||||||||||| ||||||||||| ||||||||||||||||-|
  17285 CTGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAAT

    400     .    :    .    :    .    :    .
    394 ACATCTCCAGC TGCTTAGATCCCAGCTTCGGGAGCAG
        |||||||||||-| |||||||| ||||| ||| |||||
  17335 ACATCTCCAGCCTCCTTAGATCACAGCTCCGGAAGCAG

END