Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA578974.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA578974.1, 432 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|2357158|gb|AA578974.1|AA578974 nf26f10.s1 NCI_CGAP_Pr1 Homo sapiens cDNA clone IMAGE:914923 similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

5-315  (2-312)   98% <-
316-432  (17255-17372)   87%

      0     .    :    .    :    .    :    .    :    .    :
      5 TTTTCTATAGAACATTAGGGATAAAAGATCAACAGCAATCTACCAACTCC
        |||||||||||||||||  |||||||||||||||||||||||||||||||
      2 TTTTCTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCC

     50     .    :    .    :    .    :    .    :    .    :
     55 AGGACCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     52 AGGACCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATG

    100     .    :    .    :    .    :    .    :    .    :
    105 TTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTCATCA
        ||||||||||||||||||||||||||||||||||||||||||||| ||||
    102 TTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCA

    150     .    :    .    :    .    :    .    :    .    :
    155 AACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    152 AACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGA

    200     .    :    .    :    .    :    .    :    .    :
    205 GCAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    202 GCAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTT

    250     .    :    .    :    .    :    .    :    .    :
    255 CCTACATCCTGTAGTTCGTGTTTCCTGCACTCCCTCTACTTGCGTTCTTC
        ||||||||||||||||| ||||||||||||||||||||||||||||||||
    252 CCTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTC

    300     .    :    .    :    .    :    .    :    .    :
    305 AGATGTACTTC         CTTCTGGGTCTTGAGCATGTCGATATGGCG
        | |||||||||<<<...<<<||||||||||||| |||||||| | |||||
    302 AAATGTACTTCCTA...TACCTTCTGGGTCTTGGGCATGTCGGTGTGGCG

    350     .    :    .    :    .    :    .    :    .    :
    346 CTGGGAACAGACAGGGCGAGCTGACTTGGGAGGCATGAGAGGTACGCAAT
        ||||| || ||||| |||||||||||||| |||| |||| ||| ||||||
  17285 CTGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAAT

    400     .    :    .    :    .    :    .
    396 AAATCTCAAGCCTC TTAGATCACAGGTCCCGAAGCAG
        | ||||| ||||||-||||||||||| ||| |||||||
  17335 ACATCTCCAGCCTCCTTAGATCACAGCTCCGGAAGCAG

END