Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA595528.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA595528.1, 442 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|2410878|gb|AA595528.1|AA595528 nh22d04.s1 NCI_CGAP_Pr1 Homo sapiens cDNA clone IMAGE:953095 similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

(complement)

1-124  (60915-61038)   100% ->
125-435  (77981-78292)   95%

      0     .    :    .    :    .    :    .    :    .    :
      1 TGAGTGCTGCTTCCGGAGCTGTGATCTAAGGAGGCTGGAGATGTATTGCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  60915 TGAGTGCTGCTTCCGGAGCTGTGATCTAAGGAGGCTGGAGATGTATTGCG

     50     .    :    .    :    .    :    .    :    .    :
     51 CACCCCTCAAGCCTGCCAAGTCAGCTCGCTCTGTCCGTGCCCAGCGCCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  60965 CACCCCTCAAGCCTGCCAAGTCAGCTCGCTCTGTCCGTGCCCAGCGCCAC

    100     .    :    .    :    .    :    .    :    .    :
    101 ACCGACATGCCCAAGACCCAGAAG         GAAGTACATTTGAAGAA
        ||||||||||||||||||||||||>>>...>>>|||||||||||||||||
  61015 ACCGACATGCCCAAGACCCAGAAGGTA...TAGGAAGTACATTTGAAGAA

    150     .    :    .    :    .    :    .    :    .    :
    142 CGCAAGTAGAGGGAGTGCAGGAGACAAGAACTACAGGATGTAGGAAGACC
        |||||||||||||||||||||| |||||||||||||||||||||||||||
  77998 CGCAAGTAGAGGGAGTGCAGGAAACAAGAACTACAGGATGTAGGAAGACC

    200     .    :    .    :    .    :    .    :    .    :
    192 CTCCTGAGGAGTGAAGAGTGACATGCCACCGCA GATTCCTTTGCTCTGC
        |||||||||||||||||||||||||||||||||-|||-||||||||||||
  78048 CTCCTGAGGAGTGAAGAGTGACATGCCACCGCAGGAT CCTTTGCTCTGC

    250     .    :    .    :    .    :    .    :    .    :
    241 ACGAGTTACCTGTTAAACTTTGGAACACCTACCAAAAAATAAGTTTGATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78097 ACGAGTTACCTGTTAAACTTTGGAACACCTACCAAAAAATAAGTTTGATA

    300     .    :    .    :    .    :    .    :    .    :
    291 ACATTTAAAAGATGGGCGTGTCCCCCAATGAGATACACAAGTAAACAGTT
        ||||||||||||||||||| ||||||||||| |||||||||||||||-||
  78147 ACATTTAAAAGATGGGCGTTTCCCCCAATGAAATACACAAGTAAACA TT

    350     .    :    .    :    .    :    .    :    .    :
    341 CC GCATTGTCTTTAGGAGTGATTTGCACCTTGCGAAAATGATCCTGGAG
        ||- |||||||||||||||||||||||||||||| |||||| ||||||||
  78196 CCAACATTGTCTTTAGGAGTGATTTGCACCTTGCAAAAATGGTCCTGGAG

    400     .    :    .    :    .    :    .    :    .
    390 TTGGTAGGATGCTGTTGATCTTTTATCA TAATGTTCTATAGACACG
        |||||||  |||||||||||||||||||-|||||||||||||| | |
  78246 TTGGTAGATTGCTGTTGATCTTTTATCAATAATGTTCTATAGAAAAG

END