Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA621551.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA621551.1, 480 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|2525490|gb|AA621551.1|AA621551 af47c10.s1 Soares_total_fetus_Nb2HF8_9w Homo sapiens cDNA clone IMAGE:1034802 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

22-294  (40-312)   94% <-
295-472  (17255-17436)   97%

      0     .    :    .    :    .    :    .    :    .    :
     22 TCTAGCAGCTCCGGGACCATTGTTGCGAGGTGGAGATCACTCCGAAAGGC
        |||| || |||| |||||||| |||| ||||| | |||||||| |||| |
     40 TCTACCAACTCCAGGACCATTTTTGCAAGGTGCAAATCACTCCTAAAGAC

     50     .    :    .    :    .    :    .    :    .    :
     72 AATGGTGGAATGTTTACTTGGGTATTGCATTGGGGGAAACGCCCATCTTT
        |||| ||||||||||||||| ||||| |||||||||||||||||||||||
     90 AATGTTGGAATGTTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTT

    100     .    :    .    :    .    :    .    :    .    :
    122 GAAATGTTAGCAAACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGT
         |||||||| ||||||||||||||||||||||||||||||||||||||||
    140 TAAATGTTATCAAACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGT

    150     .    :    .    :    .    :    .    :    .    :
    172 AACTCGTGCAGAGCAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    190 AACTCGTGCAGAGCAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCT

    200     .    :    .    :    .    :    .    :    .    :
    222 CAGGAGGGTCTTCCTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    240 CAGGAGGGTCTTCCTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTA

    250     .    :    .    :    .    :    .    :    .    :
    272 CTTGCGTTCTTCAAATGTACTTC         CTTCTGGGTCTTGGGCAT
        |||||||||||||||||||||||<<<...<<<||||||||||||||||||
    290 CTTGCGTTCTTCAAATGTACTTCCTA...TACCTTCTGGGTCTTGGGCAT

    300     .    :    .    :    .    :    .    :    .    :
    313 GTCGGTGTGGCGCTGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17273 GTCGGTGTGGCGCTGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGA

    350     .    :    .    :    .    :    .    :    .    :
    363 GGGGTGCGCAATACATCTCCAGCCTCCTTAGATCACAGCTCCGGAAGCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17323 GGGGTGCGCAATACATCTCCAGCCTCCTTAGATCACAGCTCCGGAAGCAG

    400     .    :    .    :    .    :    .    :    .    :
    413 CACTCATCCACGATGCCTGTCTGAGGCGCC TCCGACTGCTGGAGC ATA
        ||||||||||||||||||||||||||||||-|||||||||||||||-|||
  17373 CACTCATCCACGATGCCTGTCTGAGGCGCCCTCCGACTGCTGGAGCCATA

    450     .    :
    461 CCC GTGG CTTGT
        |||-||||-|||||
  17423 CCCTGTGGGCTTGT

END