Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA631921.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA631921.1, 437 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|2554532|gb|AA631921.1|AA631921 np78c03.s1 NCI_CGAP_Pr2 Homo sapiens cDNA clone IMAGE:1132420 similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

(complement)

62-122  (24266-24326)   88% ==
415-431  (76896-76912)   100%

      0     .    :    .    :    .    :    .    :    .    :
     62 CTACAT ACAC AGACACACACACACACACACACACACACACACACACAC
        ||| ||-| ||-| ||||||||||||||||||||||||||||||||||||
  24266 CTAGATTAGACAATACACACACACACACACACACACACACACACACACAC

     50     .    :
    110 ACACACATTCACC
        |||||||--||||
  24316 ACACACA  CACC

      0     .    :    .
    415 AAAAAAAAAAAAAAAAA
        |||||||||||||||||
  76896 AAAAAAAAAAAAAAAAA

END