Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA639291.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA639291.1, 372 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|2563070|gb|AA639291.1|AA639291 nr19c04.s1 NCI_CGAP_Pr2 Homo sapiens cDNA clone IMAGE:1168422 similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

(complement)

1-50  (64797-64843)   88% ->
51-363  (77981-78292)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 GCTCGACACAGTTCCATGGAATAACTAAGAATTCAGAGTCCTGTGGAAAG
        |  |--||||||||||||||||||||||||||||| -|||||||||||||
  64797 GGAC  CACAGTTCCATGGAATAACTAAGAATTCAT GTCCTGTGGAAAG

     50     .    :    .    :    .    :    .    :    .    :
     51          GAAGTACATTTGAAGAACGCAAGTAGAGGGAGTGCAGGAAA
        >>>...>>>|||||||||||||||||||||||||||||||||||||||||
  64844 GTT...TAGGAAGTACATTTGAAGAACGCAAGTAGAGGGAGTGCAGGAAA

    100     .    :    .    :    .    :    .    :    .    :
     92 CAAGAACTACAGGATGTAGGAAGACCCTCCTGAGGAGTGAAGAGTGACAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78022 CAAGAACTACAGGATGTAGGAAGACCCTCCTGAGGAGTGAAGAGTGACAT

    150     .    :    .    :    .    :    .    :    .    :
    142 GCCACCGCAGTATCCTTTGCTCTGCACGAGTTACCTGTTAAACTTTGGAA
        |||||||||| |||||||||||||||||||||||||||||||||||||||
  78072 GCCACCGCAGGATCCTTTGCTCTGCACGAGTTACCTGTTAAACTTTGGAA

    200     .    :    .    :    .    :    .    :    .    :
    192 CACCTACCAAAAAATAAGTTTGATAACATTTAAAAGATGGGCGTTTCCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78122 CACCTACCAAAAAATAAGTTTGATAACATTTAAAAGATGGGCGTTTCCCC

    250     .    :    .    :    .    :    .    :    .    :
    242 CAATGAAATACACAAGTAGACATTCCAACATTGTCTTTAGGAGTGATTTG
        |||||||||||||||||| |||||||||||||||||||||||||||||||
  78172 CAATGAAATACACAAGTAAACATTCCAACATTGTCTTTAGGAGTGATTTG

    300     .    :    .    :    .    :    .    :    .    :
    292 CACCTTGGCAAAATGGTCCTGGAGTTGGTAGATTGCTGTTGATCTGTTAT
        |||||||  |||||||||||||||||||||||||||||||||||| ||||
  78222 CACCTTGCAAAAATGGTCCTGGAGTTGGTAGATTGCTGTTGATCTTTTAT

    350     .    :    .    :
    342 CAAAAATGTTCTATAGAGAAAA
        ||| |||||||||||||-||| 
  78272 CAATAATGTTCTATAGA AAAG

END