Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA640354.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA640354.1, 369 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|2565604|gb|AA640354.1|AA640354 nr21h06.s1 NCI_CGAP_Pr2 Homo sapiens cDNA clone IMAGE:1168667 similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

(complement)

1-49  (64797-64843)   93% ->
50-361  (77981-78292)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGTCGACACAGTTCCATGGAATAACTAAGAATTCATGTCCTGTGGAAAG 
        || |--|||||||||||||||||||||||||||||||||||||||||||>
  64797 GGAC  CACAGTTCCATGGAATAACTAAGAATTCATGTCCTGTGGAAAGG

     50     .    :    .    :    .    :    .    :    .    :
     50         GAAGTACATTTGAAGAACGCAAGTAGAGGGAGTGCAGGAAAC
        >>...>>>||||||||||||||||||||||||||||||||||||||||||
  64845 TT...TAGGAAGTACATTTGAAGAACGCAAGTAGAGGGAGTGCAGGAAAC

    100     .    :    .    :    .    :    .    :    .    :
     92 AAGAACTACAGGATGTAGGAAGACCCTCCTGAGGAGTGAAGAGTGACATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78023 AAGAACTACAGGATGTAGGAAGACCCTCCTGAGGAGTGAAGAGTGACATG

    150     .    :    .    :    .    :    .    :    .    :
    142 CCACCGCAGGATCCTTTGCTCTGCACGAGTTACCTGTTAAACTTTGGAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78073 CCACCGCAGGATCCTTTGCTCTGCACGAGTTACCTGTTAAACTTTGGAAC

    200     .    :    .    :    .    :    .    :    .    :
    192 ACCTACCAAAAAATAAGTTTGATAACATTTAAAAGATGGGCGTTTCCCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78123 ACCTACCAAAAAATAAGTTTGATAACATTTAAAAGATGGGCGTTTCCCCC

    250     .    :    .    :    .    :    .    :    .    :
    242 AATGAAATACACAAGTAAACATTCCAACATTGTCTTTAGGAGTGATTTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78173 AATGAAATACACAAGTAAACATTCCAACATTGTCTTTAGGAGTGATTTGC

    300     .    :    .    :    .    :    .    :    .    :
    292 ACCTTGCAAAAATGGTCCTGGAGTTGGTAGATTGCTGTTGATCTTTTATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78223 ACCTTGCAAAAATGGTCCTGGAGTTGGTAGATTGCTGTTGATCTTTTATC

    350     .    :    .    :
    342 AATAATGTTCTATAGAAAAA
        ||||||||||||||||||| 
  78273 AATAATGTTCTATAGAAAAG

END