Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA723451.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA723451.1, 363 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|2741158|gb|AA723451.1|AA723451 zg69c05.s1 Soares_fetal_heart_NbHH19W Homo sapiens cDNA clone IMAGE:398600 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);contains element LTR10 repetitive element ;, mRNA sequence
>ENSG00000017427

1-17  (24948-24964)   94% ==
243-266  (51045-51068)   83% ==
327-363  (53969-54005)   100%

      0     .    :    .
      1 CTTTTTTTTCTTTTTTT
         ||||||||||||||||
  24948 TTTTTTTTTCTTTTTTT

      0     .    :    .    :
    243 GCTTTTTGTTTGTTTGTTTGTTTT
        ||||    ||||||||||||||||
  51045 GCTTGGCATTTGTTTGTTTGTTTT

      0     .    :    .    :    .    :    .
    327 TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
        |||||||||||||||||||||||||||||||||||||
  53969 TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT

END