Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA883233.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA883233.1, 336 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|2992763|gb|AA883233.1|AA883233 am24g11.s1 Soares_NFL_T_GBC_S1 Homo sapiens cDNA clone IMAGE:1467812 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

1-221  (96-312)   95% <-
222-336  (17255-17369)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGAATGTTTAATTTGTGAATTCACATTGGGGGAAACGCCCATCTTTTAAA
        |||||||||| ||-||| ||| -|||||||||||||||||||||||||||
     96 GGAATGTTTACTT GTGTATTT CATTGGGGGAAACGCCCATCTTTTAAA

     50     .    :    .    :    .    :    .    :    .    :
     51 TGTTATCAAACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    144 TGTTATCAAACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACT

    100     .    :    .    :    .    :    .    :    .    :
    101 CGTGCAGAGCAAAGGATCCTGCGGTGGCATGTCACTCTTAACTCCTCCAG
        ||||||||||||||||||||||||||||||||||||||| |||||||-||
    194 CGTGCAGAGCAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTC AG

    150     .    :    .    :    .    :    .    :    .    :
    151 GAGGGTCTTCCAACAATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACT
        ||||||||||| |||-||||||||||||||||||||||||||||||||||
    243 GAGGGTCTTCCTACA TCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACT

    200     .    :    .    :    .    :    .    :    .    :
    201 TGCGTTCTTCAAATGTACTTC         CATTCTGG TCTTGGGCATG
        |||||||||||||||||||||<<<...<<<|-||||||-|||||||||||
    292 TGCGTTCTTCAAATGTACTTCCTA...TACC TTCTGGGTCTTGGGCATG

    250     .    :    .    :    .    :    .    :    .    :
    241 TCGGTGTGGCGCTGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17274 TCGGTGTGGCGCTGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAG

    300     .    :    .    :    .    :    .    :    .
    291 GGGTGCGCAATACATCTCCAGCCTCCTTAGATCACAGCTCCGGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||
  17324 GGGTGCGCAATACATCTCCAGCCTCCTTAGATCACAGCTCCGGAAG

END