Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA913900.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA913900.1, 527 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|3053292|gb|AA913900.1|AA913900 ol35g05.s2 Soares_NFL_T_GBC_S1 Homo sapiens cDNA clone IMAGE:1525496 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

1-307  (6-312)   100% <-
308-489  (17255-17436)   99% <-
490-527  (73389-73426)   94%

      0     .    :    .    :    .    :    .    :    .    :
      1 CTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCCAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      6 CTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCCAGGA

     50     .    :    .    :    .    :    .    :    .    :
     51 CCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGTTTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     56 CCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGTTTA

    100     .    :    .    :    .    :    .    :    .    :
    101 CTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAAACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    106 CTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAAACT

    150     .    :    .    :    .    :    .    :    .    :
    151 TATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAGCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    156 TATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAGCAA

    200     .    :    .    :    .    :    .    :    .    :
    201 AGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTCCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    206 AGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTCCTA

    250     .    :    .    :    .    :    .    :    .    :
    251 CATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    256 CATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAAT

    300     .    :    .    :    .    :    .    :    .    :
    301 GTACTTC         CTTCTGGGTCTTGGGCATGTCGGTGTGGCGCTGG
        |||||||<<<...<<<||||||||||||||||||||||||||||||||||
    306 GTACTTCCTA...TACCTTCTGGGTCTTGGGCATGTCGGTGTGGCGCTGG

    350     .    :    .    :    .    :    .    :    .    :
    342 GCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAATACAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17289 GCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAATACAT

    400     .    :    .    :    .    :    .    :    .    :
    392 CTCCAGCCTCCTTAGATCACAGCTCCGGAAGCAGCACTCATCCACGATGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17339 CTCCAGCCTCCTTAGATCACAGCTCCGGAAGCAGCACTCATCCACGATGC

    450     .    :    .    :    .    :    .    :    .    :
    442 CTGTCTTAGGCGCCCTCCGACTGCTGGAGCCATACCCTGTGGGCTTGT  
        |||||| |||||||||||||||||||||||||||||||||||||||||<<
  17389 CTGTCTGAGGCGCCCTCCGACTGCTGGAGCCATACCCTGTGGGCTTGTCT

    500     .    :    .    :    .    :    .    :    .
    490        TGTAAATAAA GCCCCTGTCTCCACACACGAACTGAAGA
        <...<<<||-|||||||-||||||||||||||||||||||||||||
  17439 G...TACTG AAATAAAAGCCCCTGTCTCCACACACGAACTGAAGA

END