Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AA993659.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AA993659.1, 486 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|3180204|gb|AA993659.1|AA993659 ot85g11.s1 Soares_total_fetus_Nb2HF8_9w Homo sapiens cDNA clone IMAGE:1623620 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

2-312  (2-312)   100% <-
313-486  (17255-17429)   98%

      0     .    :    .    :    .    :    .    :    .    :
      2 TTTTCTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      2 TTTTCTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCC

     50     .    :    .    :    .    :    .    :    .    :
     52 AGGACCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     52 AGGACCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATG

    100     .    :    .    :    .    :    .    :    .    :
    102 TTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    102 TTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCA

    150     .    :    .    :    .    :    .    :    .    :
    152 AACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    152 AACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGA

    200     .    :    .    :    .    :    .    :    .    :
    202 GCAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    202 GCAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTT

    250     .    :    .    :    .    :    .    :    .    :
    252 CCTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    252 CCTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTC

    300     .    :    .    :    .    :    .    :    .    :
    302 AAATGTACTTC         CTTCTGGGTCTTGGGCATGTCGGTGTGGCG
        |||||||||||<<<...<<<||||||||||||||||||||||||||||||
    302 AAATGTACTTCCTA...TACCTTCTGGGTCTTGGGCATGTCGGTGTGGCG

    350     .    :    .    :    .    :    .    :    .    :
    343 CTGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17285 CTGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAAT

    400     .    :    .    :    .    :    .    :    .    :
    393 ACATCTCCAGCCTCCTTAGATCACAGCTCCGGAAGCAGCACTCATCCACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17335 ACATCTCCAGCCTCCTTAGATCACAGCTCCGGAAGCAGCACTCATCCACG

    450     .    :    .    :    .    :    .    :    .
    443 ATGGCTGTCTGAGGCGCCCTCCGACTGCTGGAGCCATACC TGTG
        ||| ||||||||||||||||||||||||||||||||||||-||||
  17385 ATGCCTGTCTGAGGCGCCCTCCGACTGCTGGAGCCATACCCTGTG

END