Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AF005068.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/AF005068.1, 5693 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|2218153|gb|AF005068.1|AF005068 Homo sapiens breast and ovarian cancer susceptibility protein splice variant (BRCA1) mRNA, complete cds
>ENSG00000012048

(complement)

1-107  (104-210)   98% ->
108-206  (1277-1375)   100% ->
207-260  (9613-9666)   100% ->
261-316  (18859-18914)   100% ->
317-405  (20436-20524)   97% ->
406-545  (21131-21270)   100% ->
546-648  (25515-25617)   100% ->
649-694  (28103-28148)   100% ->
695-771  (29470-29546)   98% ->
772-4197  (30532-33957)   99% ->
4198-4286  (34360-34448)   100% ->
4287-4458  (42817-42988)   100% ->
4459-4585  (48778-48904)   100% ->
4586-4776  (50871-51061)   100% ->
4777-5087  (54154-54464)   100% ->
5088-5175  (57697-57784)   100% ->
5176-5253  (61441-61518)   100% ->
5254-5294  (62019-62059)   100% ->
5295-5378  (68257-68340)   100% ->
5379-5433  (74275-74329)   100% ->
5434-5507  (76198-76271)   100% ->
5508-5568  (77689-77749)   100% ->
5569-5693  (79590-79714)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 CCTCTGCTCTGGGTAAAGTTAGTGGAGTCCCGGGAAAGGGACAGGGGGCC
        |||||||||||||||||| |||| ||||||||||||||||||||||||||
    104 CCTCTGCTCTGGGTAAAGGTAGTAGAGTCCCGGGAAAGGGACAGGGGGCC

     50     .    :    .    :    .    :    .    :    .    :
     51 CAAGTGATGCTCTGGGGTACTGGCGTGGGAGAGTGGATTTCCGAAGCTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    154 CAAGTGATGCTCTGGGGTACTGGCGTGGGAGAGTGGATTTCCGAAGCTGA

    100     .    :    .    :    .    :    .    :    .    :
    101 CAGATGG         TTCATTGGAACAGAAAGAAATGGATTTATCTGCT
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
    204 CAGATGGGTA...AAGTTCATTGGAACAGAAAGAAATGGATTTATCTGCT

    150     .    :    .    :    .    :    .    :    .    :
    142 CTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1311 CTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTT

    200     .    :    .    :    .    :    .    :    .    :
    192 AGAGTGTCCCATCTG         TCTGGAGTTGATCAAGGAACCTGTCT
        |||||||||||||||>>>...>>>||||||||||||||||||||||||||
   1361 AGAGTGTCCCATCTGGTA...TAGTCTGGAGTTGATCAAGGAACCTGTCT

    250     .    :    .    :    .    :    .    :    .    :
    233 CCACAAAGTGTGACCACATATTTTGCAA         ATTTTGCATGCTG
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
   9639 CCACAAAGTGTGACCACATATTTTGCAAGTA...TAGATTTTGCATGCTG

    300     .    :    .    :    .    :    .    :    .    :
    274 AAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTGTCCTTTAT       
        |||||||||||||||||||||||||||||||||||||||||||>>>...>
  18872 AAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTGTCCTTTATGTA...C

    350     .    :    .    :    .    :    .    :    .    :
    317   GAGCCTACAAGAAAGTACGAGATTCAGTCAACTTGTTGAAGAGCTATT
        >>|||||||||||||||||||||||| |||||||||||||||||||||||
  20434 AGGAGCCTACAAGAAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATT

    400     .    :    .    :    .    :    .    :    .    :
    365 GAAAACCATTTGTGCTTTTCAGCTTGACACAGGTTTGGAGT         
        ||||| |||||||||||||||||||||||||||||||||||>>>...>>>
  20484 GAAAATCATTTGTGCTTTTCAGCTTGACACAGGTTTGGAGTGTA...CAG

    450     .    :    .    :    .    :    .    :    .    :
    406 ATGCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21131 ATGCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACAT

    500     .    :    .    :    .    :    .    :    .    :
    456 CTAAAAGATGAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21181 CTAAAAGATGAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGC

    550     .    :    .    :    .    :    .    :    .    :
    506 CAAAAGACTTCTACAGAGTGAACCCGAAAATCCTTCCTTG         G
        ||||||||||||||||||||||||||||||||||||||||>>>...>>>|
  21231 CAAAAGACTTCTACAGAGTGAACCCGAAAATCCTTCCTTGGTA...CAGG

    600     .    :    .    :    .    :    .    :    .    :
    547 AAACCAGTCTCAGTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25516 AAACCAGTCTCAGTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTG

    650     .    :    .    :    .    :    .    :    .    :
    597 AGGACAAAGCAGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25566 AGGACAAAGCAGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATT

    700     .    :    .    :    .    :    .    :    .    :
    647 GG         GATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTT
        ||>>>...>>>|||||||||||||||||||||||||||||||||||||||
  25616 GGGTA...TAGGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTT

    750     .    :    .    :    .    :    .    :    .    :
    688 ATTGCAG         TGTGGGAGATCAAGAATTGTTACAAATCACCCCT
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
  28142 ATTGCAGGTG...TAGTGTGGGAGATCAAGAATTGTTACAAATCACCCCT

    800     .    :    .    :    .    :    .    :    .    :
    729 CAAGGAACCAGGGATGAAATCAGTTTGGACTCTGCAAAAAAGG       
        ||||||||||||||||||||||||||||| |||||||||||||>>>...>
  29504 CAAGGAACCAGGGATGAAATCAGTTTGGATTCTGCAAAAAAGGGTA...C

    850     .    :    .    :    .    :    .    :    .    :
    772   CTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATC
        >>||||||||||||||||||||||||||||||||||||||||||||||||
  30530 AGCTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATC

    900     .    :    .    :    .    :    .    :    .    :
    820 AACCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30580 AACCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGG

    950     .    :    .    :    .    :    .    :    .    :
    870 CATCCAGAAAAGTATCAGGGTAGTTCTGTTTCAAACTTGCATGTGGAGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30630 CATCCAGAAAAGTATCAGGGTAGTTCTGTTTCAAACTTGCATGTGGAGCC

   1000     .    :    .    :    .    :    .    :    .    :
    920 ATGTGGCACAAATACTCATGCCAGCTCATTACAGCATGAGAACAGCAGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30680 ATGTGGCACAAATACTCATGCCAGCTCATTACAGCATGAGAACAGCAGTT

   1050     .    :    .    :    .    :    .    :    .    :
    970 TATTACTCACTAAAGACAGAATGAATGTAGAAAAGGCTGAATTCTGTAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30730 TATTACTCACTAAAGACAGAATGAATGTAGAAAAGGCTGAATTCTGTAAT

   1100     .    :    .    :    .    :    .    :    .    :
   1020 AAAAGCAAACAGCCTGGCTTAGCAAGGAGCCAACATAACAGATGGGCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30780 AAAAGCAAACAGCCTGGCTTAGCAAGGAGCCAACATAACAGATGGGCTGG

   1150     .    :    .    :    .    :    .    :    .    :
   1070 AAGTAAGGAAACATGTAATGATAGGCGGACTCCCAGCACAGAAAAAAAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30830 AAGTAAGGAAACATGTAATGATAGGCGGACTCCCAGCACAGAAAAAAAGG

   1200     .    :    .    :    .    :    .    :    .    :
   1120 TAGATCTGAATGCTGATCCCCTGTGTGAGAGAAAAGAATGGAATAAGCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30880 TAGATCTGAATGCTGATCCCCTGTGTGAGAGAAAAGAATGGAATAAGCAG

   1250     .    :    .    :    .    :    .    :    .    :
   1170 AAACTGCCATGCTCAGAGAATCCTAGAGATACTGAAGATGTTCCTTGGAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30930 AAACTGCCATGCTCAGAGAATCCTAGAGATACTGAAGATGTTCCTTGGAT

   1300     .    :    .    :    .    :    .    :    .    :
   1220 AACACTAAATAGCAGCATTCAGAAAGTTAATGAGTGGTTTTCCAGAAGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30980 AACACTAAATAGCAGCATTCAGAAAGTTAATGAGTGGTTTTCCAGAAGTG

   1350     .    :    .    :    .    :    .    :    .    :
   1270 ATGAACTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31030 ATGAACTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAAAT

   1400     .    :    .    :    .    :    .    :    .    :
   1320 GCCAAAGTAGCTGATGTATTGGACGTTCTAAATGAGGTAGATGAATATTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31080 GCCAAAGTAGCTGATGTATTGGACGTTCTAAATGAGGTAGATGAATATTC

   1450     .    :    .    :    .    :    .    :    .    :
   1370 TGGTTCTTCAGAGAAAATAGACTTACTGGCCAGTGATCCTCATGAGGCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31130 TGGTTCTTCAGAGAAAATAGACTTACTGGCCAGTGATCCTCATGAGGCTT

   1500     .    :    .    :    .    :    .    :    .    :
   1420 TAATATGTAAAAGTGAAAGAGTTCACTCCAAATCAGTAGAGAGTAATATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31180 TAATATGTAAAAGTGAAAGAGTTCACTCCAAATCAGTAGAGAGTAATATT

   1550     .    :    .    :    .    :    .    :    .    :
   1470 GAAGACAAAATATTTGGGAAAACCTATCGGAAGAAGGCAAGCCTCCCCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31230 GAAGACAAAATATTTGGGAAAACCTATCGGAAGAAGGCAAGCCTCCCCAA

   1600     .    :    .    :    .    :    .    :    .    :
   1520 CTTAAGCCATGTAACTGAAAATCTAATTATAGGAGCATTTGTTACTGAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31280 CTTAAGCCATGTAACTGAAAATCTAATTATAGGAGCATTTGTTACTGAGC

   1650     .    :    .    :    .    :    .    :    .    :
   1570 CACAGATAATACAAGAGCGTCCCCTCACAAATAAATTAAAGCGTAAAAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31330 CACAGATAATACAAGAGCGTCCCCTCACAAATAAATTAAAGCGTAAAAGG

   1700     .    :    .    :    .    :    .    :    .    :
   1620 AGACCTACATCAGGCCTTCATCCTGAGGATTTTATCAAGAAAGCAGATTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31380 AGACCTACATCAGGCCTTCATCCTGAGGATTTTATCAAGAAAGCAGATTT

   1750     .    :    .    :    .    :    .    :    .    :
   1670 GGCAGTTCAAAAGACTCCTGAAATGATAAATCAGGGAACTAACCAAACGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31430 GGCAGTTCAAAAGACTCCTGAAATGATAAATCAGGGAACTAACCAAACGG

   1800     .    :    .    :    .    :    .    :    .    :
   1720 AGCAGAATGGTCAAGTGATGAATATTACTAATAGTGGTCATGAGAATAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31480 AGCAGAATGGTCAAGTGATGAATATTACTAATAGTGGTCATGAGAATAAA

   1850     .    :    .    :    .    :    .    :    .    :
   1770 ACAAAAGGTGATTCTATTCAGAATGAGAAAAATCCTAACCCAATAGAATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31530 ACAAAAGGTGATTCTATTCAGAATGAGAAAAATCCTAACCCAATAGAATC

   1900     .    :    .    :    .    :    .    :    .    :
   1820 ACTCGAAAAAGAATCTGCTTTCAAAACGAAAGCTGAACCTATAAGCAGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31580 ACTCGAAAAAGAATCTGCTTTCAAAACGAAAGCTGAACCTATAAGCAGCA

   1950     .    :    .    :    .    :    .    :    .    :
   1870 GTATAAGCAATATGGAACTCGAATTAAATATCCACAATTCAAAAGCACCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31630 GTATAAGCAATATGGAACTCGAATTAAATATCCACAATTCAAAAGCACCT

   2000     .    :    .    :    .    :    .    :    .    :
   1920 AAAAAGAATAGGCTGAGGAGGAAGTCTTCTACCAGGCATATTCATGCGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31680 AAAAAGAATAGGCTGAGGAGGAAGTCTTCTACCAGGCATATTCATGCGCT

   2050     .    :    .    :    .    :    .    :    .    :
   1970 TGAACTAGTAGTCAGTAGAAATCTAAGCCCACCTAATTGTACTGAATTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31730 TGAACTAGTAGTCAGTAGAAATCTAAGCCCACCTAATTGTACTGAATTGC

   2100     .    :    .    :    .    :    .    :    .    :
   2020 AAATTGATAGTTGTTCTAGCAGTGAAGAGATAAAGAAAAAAAAGTACAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31780 AAATTGATAGTTGTTCTAGCAGTGAAGAGATAAAGAAAAAAAAGTACAAC

   2150     .    :    .    :    .    :    .    :    .    :
   2070 CAAATGCCAGTCAGGCACAGCAGAAACCTACAACTCATGGAAGGTAAAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31830 CAAATGCCAGTCAGGCACAGCAGAAACCTACAACTCATGGAAGGTAAAGA

   2200     .    :    .    :    .    :    .    :    .    :
   2120 ACCTGCAACTGGAGCCAAGAAGAGTAACAAGCCAAATGAACAGACAAGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31880 ACCTGCAACTGGAGCCAAGAAGAGTAACAAGCCAAATGAACAGACAAGTA

   2250     .    :    .    :    .    :    .    :    .    :
   2170 AAAGACATGACAGCGATACTTTCCCAGAGCTGAAGTTAACAAATGCACCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31930 AAAGACATGACAGCGATACTTTCCCAGAGCTGAAGTTAACAAATGCACCT

   2300     .    :    .    :    .    :    .    :    .    :
   2220 GGTTCTTTTACTAAGTGTTCAAATACCAGTGAACTTAAAGAATTTGTCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31980 GGTTCTTTTACTAAGTGTTCAAATACCAGTGAACTTAAAGAATTTGTCAA

   2350     .    :    .    :    .    :    .    :    .    :
   2270 TCCTAGCCTTCCAAGAGAAGAAAAAGAAGAGAAACTAGAAACAGTTAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32030 TCCTAGCCTTCCAAGAGAAGAAAAAGAAGAGAAACTAGAAACAGTTAAAG

   2400     .    :    .    :    .    :    .    :    .    :
   2320 TGTCTAATAATGCTGAAGACCCCAAAGATCTCATGTTAAGTGGAGAAAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32080 TGTCTAATAATGCTGAAGACCCCAAAGATCTCATGTTAAGTGGAGAAAGG

   2450     .    :    .    :    .    :    .    :    .    :
   2370 GTTTTGCAAACTGAAAGATCTGTAGAGAGTAGCAGTATTTCATTGGTACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32130 GTTTTGCAAACTGAAAGATCTGTAGAGAGTAGCAGTATTTCATTGGTACC

   2500     .    :    .    :    .    :    .    :    .    :
   2420 TGGTACTGATTATGGCACTCAGGAAAGTATCTCGTTACTGGAAGTTAGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32180 TGGTACTGATTATGGCACTCAGGAAAGTATCTCGTTACTGGAAGTTAGCA

   2550     .    :    .    :    .    :    .    :    .    :
   2470 CTCTAGGGAAGGCAAAAACAGAACCAAATAAATGTGTGAGTCAGTGTGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32230 CTCTAGGGAAGGCAAAAACAGAACCAAATAAATGTGTGAGTCAGTGTGCA

   2600     .    :    .    :    .    :    .    :    .    :
   2520 GCATTTGAAAACCCCAAGGGACTAATTCATGGTTGTTCCAAAGATAATAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32280 GCATTTGAAAACCCCAAGGGACTAATTCATGGTTGTTCCAAAGATAATAG

   2650     .    :    .    :    .    :    .    :    .    :
   2570 AAATGACACAGAAGGCTTTAAGTATCCATTGGGACATGAAGTTAACCACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32330 AAATGACACAGAAGGCTTTAAGTATCCATTGGGACATGAAGTTAACCACA

   2700     .    :    .    :    .    :    .    :    .    :
   2620 GTCGGGAAACAAGCATAGAAATGGAAGAAAGTGAACTTGATGCTCAGTAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32380 GTCGGGAAACAAGCATAGAAATGGAAGAAAGTGAACTTGATGCTCAGTAT

   2750     .    :    .    :    .    :    .    :    .    :
   2670 TTGCAGAATACATTCAAGGTTTCAAAGCGCCAGTCATTTGCTCCGTTTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32430 TTGCAGAATACATTCAAGGTTTCAAAGCGCCAGTCATTTGCTCCGTTTTC

   2800     .    :    .    :    .    :    .    :    .    :
   2720 AAATCCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32480 AAATCCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTG

   2850     .    :    .    :    .    :    .    :    .    :
   2770 GGTCCTTAAAGAAACAAAGTCCAAAAGTCACTTTTGAATGTGAACAAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32530 GGTCCTTAAAGAAACAAAGTCCAAAAGTCACTTTTGAATGTGAACAAAAG

   2900     .    :    .    :    .    :    .    :    .    :
   2820 GAAGAAAATCAAGGAAAGAATGAGTCTAATATCAAGCCTGTACAGACAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32580 GAAGAAAATCAAGGAAAGAATGAGTCTAATATCAAGCCTGTACAGACAGT

   2950     .    :    .    :    .    :    .    :    .    :
   2870 TAATATCACTGCAGGCTTTCCTGTGGTTGGTCAGAAAGATAAGCCAGTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32630 TAATATCACTGCAGGCTTTCCTGTGGTTGGTCAGAAAGATAAGCCAGTTG

   3000     .    :    .    :    .    :    .    :    .    :
   2920 ATAATGCCAAATGTAGTATCAAAGGAGGCTCTAGGTTTTGTCTATCATCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32680 ATAATGCCAAATGTAGTATCAAAGGAGGCTCTAGGTTTTGTCTATCATCT

   3050     .    :    .    :    .    :    .    :    .    :
   2970 CAGTTCAGAGGCAACGAAACTGGACTCATTACTCCAAATAAACATGGACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32730 CAGTTCAGAGGCAACGAAACTGGACTCATTACTCCAAATAAACATGGACT

   3100     .    :    .    :    .    :    .    :    .    :
   3020 TTTACAAAACCCATATCGTATACCACCACTTTTTCCCATCAAGTCATTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32780 TTTACAAAACCCATATCGTATACCACCACTTTTTCCCATCAAGTCATTTG

   3150     .    :    .    :    .    :    .    :    .    :
   3070 TTAAAACTAAATGTAAGAAAAATCTGCTAGAGGAAAACTTTGAGGAACAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32830 TTAAAACTAAATGTAAGAAAAATCTGCTAGAGGAAAACTTTGAGGAACAT

   3200     .    :    .    :    .    :    .    :    .    :
   3120 TCAATGTCACCTGAAAGAGAAATGGGAAATGAGAACATTCCAAGTACAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32880 TCAATGTCACCTGAAAGAGAAATGGGAAATGAGAACATTCCAAGTACAGT

   3250     .    :    .    :    .    :    .    :    .    :
   3170 GAGCACAATTAGCCGTAATAACATTAGAGAAAATGTTTTTAAAGAAGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32930 GAGCACAATTAGCCGTAATAACATTAGAGAAAATGTTTTTAAAGAAGCCA

   3300     .    :    .    :    .    :    .    :    .    :
   3220 GCTCAAGCAATATTAATGAAGTAGGTTCCAGTACTAATGAAGTGGGCTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32980 GCTCAAGCAATATTAATGAAGTAGGTTCCAGTACTAATGAAGTGGGCTCC

   3350     .    :    .    :    .    :    .    :    .    :
   3270 AGTATTAATGAAATAGGTTCCAGTGATGAAAACATTCAAGCAGAACTAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33030 AGTATTAATGAAATAGGTTCCAGTGATGAAAACATTCAAGCAGAACTAGG

   3400     .    :    .    :    .    :    .    :    .    :
   3320 TAGAAACAGAAGGCCCAAATTGAATGCTATGCTTAGATTAGGGGTTTTGC
        |||||||||| |||| ||||||||||||||||||||||||||||||||||
  33080 TAGAAACAGAGGGCCAAAATTGAATGCTATGCTTAGATTAGGGGTTTTGC

   3450     .    :    .    :    .    :    .    :    .    :
   3370 AACCTGAGGTCTATAAACAAAGTCTTCCTGGAAGTAATTGTAAGCATCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33130 AACCTGAGGTCTATAAACAAAGTCTTCCTGGAAGTAATTGTAAGCATCCT

   3500     .    :    .    :    .    :    .    :    .    :
   3420 GAAATAAAAAAGCAAGAATATGAAGAAGTAGTTCAGACTGTTAATACAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33180 GAAATAAAAAAGCAAGAATATGAAGAAGTAGTTCAGACTGTTAATACAGA

   3550     .    :    .    :    .    :    .    :    .    :
   3470 TTTCTCTCCATATCTGATTTCAGATAACTTAGAACAGCCTATGGGAAGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33230 TTTCTCTCCATATCTGATTTCAGATAACTTAGAACAGCCTATGGGAAGTA

   3600     .    :    .    :    .    :    .    :    .    :
   3520 GTCATGCATCTCAGGTTTGTTCTGAGACACCTGATGACCTGTTAGATGAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33280 GTCATGCATCTCAGGTTTGTTCTGAGACACCTGATGACCTGTTAGATGAT

   3650     .    :    .    :    .    :    .    :    .    :
   3570 GGTGAAATAAAGGAAGATACTAGTTTTGCTGAAAATGACATTAAGGAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33330 GGTGAAATAAAGGAAGATACTAGTTTTGCTGAAAATGACATTAAGGAAAG

   3700     .    :    .    :    .    :    .    :    .    :
   3620 TTCTGCTGTTTTTAGCAAAAGCGTCCAGAAAGGAGAGCTTAGCAGGAGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33380 TTCTGCTGTTTTTAGCAAAAGCGTCCAGAAAGGAGAGCTTAGCAGGAGTC

   3750     .    :    .    :    .    :    .    :    .    :
   3670 CTAGCCCTTTCACCCATACACATTTGGCTCAGGGTTACCGAAGAGGGGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33430 CTAGCCCTTTCACCCATACACATTTGGCTCAGGGTTACCGAAGAGGGGCC

   3800     .    :    .    :    .    :    .    :    .    :
   3720 AAGAAATTAGAGTCCTCAGAAGAGAACTTATCTAGTGAGGATGAAGAGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33480 AAGAAATTAGAGTCCTCAGAAGAGAACTTATCTAGTGAGGATGAAGAGCT

   3850     .    :    .    :    .    :    .    :    .    :
   3770 TCCCTGCTTCCAACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33530 TCCCTGCTTCCAACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTC

   3900     .    :    .    :    .    :    .    :    .    :
   3820 AGTCTACTAGGCATAGCACCGTTGCTACCGAGTGTCTGTCTAAGAACACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33580 AGTCTACTAGGCATAGCACCGTTGCTACCGAGTGTCTGTCTAAGAACACA

   3950     .    :    .    :    .    :    .    :    .    :
   3870 GAGGAGAATTTATTATCATTGAAGAATAGCTTAAATGACTGCAGTAACCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33630 GAGGAGAATTTATTATCATTGAAGAATAGCTTAAATGACTGCAGTAACCA

   4000     .    :    .    :    .    :    .    :    .    :
   3920 GGTAATATTGGCAAAGGCATCTCAGGAACATCACCTTAGTGAGGAAACAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33680 GGTAATATTGGCAAAGGCATCTCAGGAACATCACCTTAGTGAGGAAACAA

   4050     .    :    .    :    .    :    .    :    .    :
   3970 AATGTTCTGCTAGCTTGTTTTCTTCACAGTGCAGTGAATTGGAAGACTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33730 AATGTTCTGCTAGCTTGTTTTCTTCACAGTGCAGTGAATTGGAAGACTTG

   4100     .    :    .    :    .    :    .    :    .    :
   4020 ACTGCAAATACAAACACCCAGGATCCTTTCTTGATTGGTTCTTCCAAACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33780 ACTGCAAATACAAACACCCAGGATCCTTTCTTGATTGGTTCTTCCAAACA

   4150     .    :    .    :    .    :    .    :    .    :
   4070 AATGAGGCATCAGTCTGAAAGCCAGGGAGTTGGTCTGAGTGACAAGGAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33830 AATGAGGCATCAGTCTGAAAGCCAGGGAGTTGGTCTGAGTGACAAGGAAT

   4200     .    :    .    :    .    :    .    :    .    :
   4120 TGGTTTCAGATGATGAAGAAAGAGGAACGGGCTTGGAAGAAAATAATCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33880 TGGTTTCAGATGATGAAGAAAGAGGAACGGGCTTGGAAGAAAATAATCAA

   4250     .    :    .    :    .    :    .    :    .    :
   4170 GAAGAGCAAAGCATGGATTCAAACTTAG         GTGAAGCAGCATC
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
  33930 GAAGAGCAAAGCATGGATTCAAACTTAGGTA...AAGGTGAAGCAGCATC

   4300     .    :    .    :    .    :    .    :    .    :
   4211 TGGGTGTGAGAGTGAAACAAGCGTCTCTGAAGACTGCTCAGGGCTATCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  34373 TGGGTGTGAGAGTGAAACAAGCGTCTCTGAAGACTGCTCAGGGCTATCCT

   4350     .    :    .    :    .    :    .    :    .    :
   4261 CTCAGAGTGACATTTTAACCACTCAG         CAGAGGGATACCATG
        ||||||||||||||||||||||||||>>>...>>>|||||||||||||||
  34423 CTCAGAGTGACATTTTAACCACTCAGGTA...AAGCAGAGGGATACCATG

   4400     .    :    .    :    .    :    .    :    .    :
   4302 CAACATAACCTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42832 CAACATAACCTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGT

   4450     .    :    .    :    .    :    .    :    .    :
   4352 GTTAGAACAGCATGGGAGCCAGCCTTCTAACAGCTACCCTTCCATCATAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42882 GTTAGAACAGCATGGGAGCCAGCCTTCTAACAGCTACCCTTCCATCATAA

   4500     .    :    .    :    .    :    .    :    .    :
   4402 GTGACTCTTCTGCCCTTGAGGACCTGCGAAATCCAGAACAAAGCACATCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42932 GTGACTCTTCTGCCCTTGAGGACCTGCGAAATCCAGAACAAAGCACATCA

   4550     .    :    .    :    .    :    .    :    .    :
   4452 GAAAAAG         CAGTATTAACTTCACAGAAAAGTAGTGAATACCC
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
  42982 GAAAAAGGTG...AAGCAGTATTAACTTCACAGAAAAGTAGTGAATACCC

   4600     .    :    .    :    .    :    .    :    .    :
   4493 TATAAGCCAGAATCCAGAAGGCCTTTCTGCTGACAAGTTTGAGGTGTCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  48812 TATAAGCCAGAATCCAGAAGGCCTTTCTGCTGACAAGTTTGAGGTGTCTG

   4650     .    :    .    :    .    :    .    :    .    :
   4543 CAGATAGTTCTACCAGTAAAAATAAAGAACCAGGAGTGGAAAG       
        |||||||||||||||||||||||||||||||||||||||||||>>>...>
  48862 CAGATAGTTCTACCAGTAAAAATAAAGAACCAGGAGTGGAAAGGTA...T

   4700     .    :    .    :    .    :    .    :    .    :
   4586   GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCA
        >>||||||||||||||||||||||||||||||||||||||||||||||||
  50869 AGGTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCA

   4750     .    :    .    :    .    :    .    :    .    :
   4634 CAGTTGCTCTGGGAGTCTTCAGAATAGAAACTACCCATCTCAAGAGGAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50919 CAGTTGCTCTGGGAGTCTTCAGAATAGAAACTACCCATCTCAAGAGGAGC

   4800     .    :    .    :    .    :    .    :    .    :
   4684 TCATTAAGGTTGTTGATGTGGAGGAGCAACAGCTGGAAGAGTCTGGGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50969 TCATTAAGGTTGTTGATGTGGAGGAGCAACAGCTGGAAGAGTCTGGGCCA

   4850     .    :    .    :    .    :    .    :    .    :
   4734 CACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG       
        |||||||||||||||||||||||||||||||||||||||||||>>>...>
  51019 CACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAGGTA...C

   4900     .    :    .    :    .    :    .    :    .    :
   4777   AGGGAACCCCTTACCTGGAATCTGGAATCAGCCTCTTCTCTGATGACC
        >>||||||||||||||||||||||||||||||||||||||||||||||||
  54152 AGAGGGAACCCCTTACCTGGAATCTGGAATCAGCCTCTTCTCTGATGACC

   4950     .    :    .    :    .    :    .    :    .    :
   4825 CTGAATCTGATCCTTCTGAAGACAGAGCCCCAGAGTCAGCTCGTGTTGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54202 CTGAATCTGATCCTTCTGAAGACAGAGCCCCAGAGTCAGCTCGTGTTGGC

   5000     .    :    .    :    .    :    .    :    .    :
   4875 AACATACCATCTTCAACCTCTGCATTGAAAGTTCCCCAATTGAAAGTTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54252 AACATACCATCTTCAACCTCTGCATTGAAAGTTCCCCAATTGAAAGTTGC

   5050     .    :    .    :    .    :    .    :    .    :
   4925 AGAATCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGATACTGCTGGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54302 AGAATCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGATACTGCTGGGT

   5100     .    :    .    :    .    :    .    :    .    :
   4975 ATAATGCAATGGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGACAGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54352 ATAATGCAATGGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGACAGCT

   5150     .    :    .    :    .    :    .    :    .    :
   5025 TCAACAGAAAGGGTCAACAAAAGAATGTCCATGGTGGTGTCTGGCCTGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54402 TCAACAGAAAGGGTCAACAAAAGAATGTCCATGGTGGTGTCTGGCCTGAC

   5200     .    :    .    :    .    :    .    :    .    :
   5075 CCCAGAAGAATTT         ATGCTCGTGTACAAGTTTGCCAGAAAAC
        |||||||||||||>>>...>>>||||||||||||||||||||||||||||
  54452 CCCAGAAGAATTTGTG...CAGATGCTCGTGTACAAGTTTGCCAGAAAAC

   5250     .    :    .    :    .    :    .    :    .    :
   5116 ACCACATCACTTTAACTAATCTAATTACTGAAGAGACTACTCATGTTGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  57725 ACCACATCACTTTAACTAATCTAATTACTGAAGAGACTACTCATGTTGTT

   5300     .    :    .    :    .    :    .    :    .    :
   5166 ATGAAAACAG         ATGCTGAGTTTGTGTGTGAACGGACACTGAA
        ||||||||||>>>...>>>|||||||||||||||||||||||||||||||
  57775 ATGAAAACAGGTA...CAGATGCTGAGTTTGTGTGTGAACGGACACTGAA

   5350     .    :    .    :    .    :    .    :    .    :
   5207 ATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCT   
        |||||||||||||||||||||||||||||||||||||||||||||||>>>
  61472 ATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCTGTA

   5400     .    :    .    :    .    :    .    :    .    :
   5254       GGGTGACCCAGTCTATTAAAGAAAGAAAAATGCTGAATGAG   
        ...>>>|||||||||||||||||||||||||||||||||||||||||>>>
  61522 ...TAGGGGTGACCCAGTCTATTAAAGAAAGAAAAATGCTGAATGAGGTA

   5450     .    :    .    :    .    :    .    :    .    :
   5295       CATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACCA
        ...>>>||||||||||||||||||||||||||||||||||||||||||||
  62063 ...CAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACCA

   5500     .    :    .    :    .    :    .    :    .    :
   5339 CCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAG         A
        ||||||||||||||||||||||||||||||||||||||||>>>...>>>|
  68301 CCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAGGTA...CAGA

   5550     .    :    .    :    .    :    .    :    .    :
   5380 TCTTCAGGGGGCTAGAAATCTGTTGCTATGGGCCCTTCACCAACATGCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  74276 TCTTCAGGGGGCTAGAAATCTGTTGCTATGGGCCCTTCACCAACATGCCC

   5600     .    :    .    :    .    :    .    :    .    :
   5430 ACAG         ATCAACTGGAATGGATGGTACAGCTGTGTGGTGCTTC
        ||||>>>...>>>|||||||||||||||||||||||||||||||||||||
  74326 ACAGGTA...TAGATCAACTGGAATGGATGGTACAGCTGTGTGGTGCTTC

   5650     .    :    .    :    .    :    .    :    .    :
   5471 TGTGGTGAAGGAGCTTTCATCATTCACCCTTGGCACA         GGTG
        |||||||||||||||||||||||||||||||||||||>>>...>>>||||
  76235 TGTGGTGAAGGAGCTTTCATCATTCACCCTTGGCACAGTA...CAGGGTG

   5700     .    :    .    :    .    :    .    :    .    :
   5512 TCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  77693 TCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGC

   5750     .    :    .    :    .    :    .    :    .    :
   5562 TTCCATG         CAATTGGGCAGATGTGTGAGGCACCTGTGGTGAC
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
  77743 TTCCATGGTA...CAGCAATTGGGCAGATGTGTGAGGCACCTGTGGTGAC

   5800     .    :    .    :    .    :    .    :    .    :
   5603 CCGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGAGCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79624 CCGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGAGCTGG

   5850     .    :    .    :    .    :    .    :
   5653 ACACCTACCTGATACCCCAGATCCCCCACAGCCACTACTGA
        |||||||||||||||||||||||||||||||||||||||||
  79674 ACACCTACCTGATACCCCAGATCCCCCACAGCCACTACTGA

END