Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI033043.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI033043.1, 475 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|3253996|gb|AI033043.1|AI033043 ow93c12.s1 Soares_fetal_liver_spleen_1NFLS_S1 Homo sapiens cDNA clone IMAGE:1654390 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

1-307  (5-312)   99% <-
308-475  (17255-17423)   95%

      0     .    :    .    :    .    :    .    :    .    :
      1 TCTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCCAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      5 TCTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCCAGG

     50     .    :    .    :    .    :    .    :    .    :
     51 ACCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     55 ACCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGTTT

    100     .    :    .    :    .    :    .    :    .    :
    101 ACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    105 ACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAAAC

    150     .    :    .    :    .    :    .    :    .    :
    151 TTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGA CA
        |||||||||||||||||||||||||||||||||||||||||||||||-||
    155 TTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAGCA

    200     .    :    .    :    .    :    .    :    .    :
    200 AAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    205 AAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTCCT

    250     .    :    .    :    .    :    .    :    .    :
    250 ACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    255 ACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAA

    300     .    :    .    :    .    :    .    :    .    :
    300 TGTACTTC         CTTCTGGGTCTTGGGCATGTCGGTGTGGCGCTG
        ||||||||<<<...<<<|||||||||||||||||||||||||||||||||
    305 TGTACTTCCTA...TACCTTCTGGGTCTTGGGCATGTCGGTGTGGCGCTG

    350     .    :    .    :    .    :    .    :    .    :
    341 GGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGAGTGCGCAATACA
        ||||||||||||||||||||||||||||||||||||| ||||||||||||
  17288 GGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAATACA

    400     .    :    .    :    .    :    .    :    .    :
    391 TCTCCAGCTTCCTTAGATCACAGCTCTGGAAGCAGCACTCATCCACGATG
        |||||||| ||||||||||||||||| |||||||||||||||||||||||
  17338 TCTCCAGCCTCCTTAGATCACAGCTCCGGAAGCAGCACTCATCCACGATG

    450     .    :    .    :    .    :    .
    441 CCTGTCTGAGGCGCC TCCGAATTGTGAAGCCATAC
        |||||||||||||||-||||| |  || ||||||||
  17388 CCTGTCTGAGGCGCCCTCCGACTGCTGGAGCCATAC

END