Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI160426.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI160426.1, 589 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|3693806|gb|AI160426.1|AI160426 qc08e09.x1 Soares_fetal_heart_NbHH19W Homo sapiens cDNA clone IMAGE:1709032 3' similar to gb:X04434_cds1 INSULIN-LIKE GROWTH FACTOR I RECEPTOR PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000140443

(complement)

43-204  (66801-66958)   97% <-
205-589  (250176-250559)   98%

      0     .    :    .    :    .    :    .    :    .    :
     43 GGGCAGGGGCAGGGGCAGGCACACAGACACCGGCATAGTAGTAGTGGCGG
        ||||--|||||-||-|||||||||||||||||||||||||||||||||||
  66801 GGGC  GGGCA GG CAGGCACACAGACACCGGCATAGTAGTAGTGGCGG

     50     .    :    .    :    .    :    .    :    .    :
     93 CAAGCTACACAGGCCGTGTCGTTGTCAGGCGCGCTGCAGCTGCCCAGGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  66847 CAAGCTACACAGGCCGTGTCGTTGTCAGGCGCGCTGCAGCTGCCCAGGCA

    100     .    :    .    :    .    :    .    :    .    :
    143 CTCGGGGTGGCAGCACTCATTGTTCTCGGTGCACGCCCGCTTCCCACACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  66897 CTCGGGGTGGCAGCACTCATTGTTCTCGGTGCACGCCCGCTTCCCACACG

    150     .    :    .    :    .    :    .    :    .    :
    193 TGCTTGGGCACA         TTTTCTGGCAGCGGTTTGTGGTCCAGCAG
        ||||||||||||<<<...<<<|||||||||||||||||||||||||||||
  66947 TGCTTGGGCACACTG...TACTTTTCTGGCAGCGGTTTGTGGTCCAGCAG

    200     .    :    .    :    .    :    .    :    .    :
    234 CGGTAGTTGTACTCATTGTTGATGGTGGTCTTCTCACACATCGGCTTCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 250205 CGGTAGTTGTACTCATTGTTGATGGTGGTCTTCTCACACATCGGCTTCTC

    250     .    :    .    :    .    :    .    :    .    :
    284 CTCCATGGTCCCTGGACACAGGTCCCCACATTCCTTTGGGGGCTTATTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 250255 CTCCATGGTCCCTGGACACAGGTCCCCACATTCCTTTGGGGGCTTATTCC

    300     .    :    .    :    .    :    .    :    .    :
    334 CCACAATGTAGTTATTGGACACCGCATCCAGGATCAGGGACCAGTCCACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 250305 CCACAATGTAGTTATTGGACACCGCATCCAGGATCAGGGACCAGTCCACA

    350     .    :    .    :    .    :    .    :    .    :
    384 GTGGAGAGGTAACAGAGGTCAGCATTTTTCTCAATCCTGATGGCCCCCCC
        |||||||||||||||||||||||||||||||||||||||||||||||||-
 250355 GTGGAGAGGTAACAGAGGTCAGCATTTTTCTCAATCCTGATGGCCCCCC 

    400     .    :    .    :    .    :    .    :    .    :
    434 GAGTAATGTTCCTCAGGTTGTAAAGCCCAATATCCTTGAGATTGGTCATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 250404 GAGTAATGTTCCTCAGGTTGTAAAGCCCAATATCCTTGAGATTGGTCATC

    450     .    :    .    :    .    :    .    :    .    :
    484 TCGAAGATGACCAGGGCGTAGTTGTAGAAGAGTTTCCAGCCGCGGATGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 250454 TCGAAGATGACCAGGGCGTAGTTGTAGAAGAGTTTCCAGCCGCGGATGAC

    500     .    :    .    :    .    :    .    :    .    :
    534 CGTGAGGTTGGGGAAAGAGG CTCCGAGGCTCTCGAGGCCAGCCACTTCG
        |||||||||||||||-||||-||||||||||||||||||||||||||-||
 250504 CGTGAGGTTGGGGAA GAGGTCTCCGAGGCTCTCGAGGCCAGCCACT CG

    550     .
    583 GA CAGCA
        ||-|||||
 250552 GAACAGCA

END