Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI248089.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI248089.1, 575 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|3843486|gb|AI248089.1|AI248089 qh69f05.x1 Soares_fetal_liver_spleen_1NFLS_S1 Homo sapiens cDNA clone IMAGE:1849953 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

1-308  (5-312)   100% <-
309-490  (17255-17436)   100% <-
491-575  (73389-73476)   93%

      0     .    :    .    :    .    :    .    :    .    :
      1 TCTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCCAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      5 TCTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCCAGG

     50     .    :    .    :    .    :    .    :    .    :
     51 ACCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     55 ACCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGTTT

    100     .    :    .    :    .    :    .    :    .    :
    101 ACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    105 ACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAAAC

    150     .    :    .    :    .    :    .    :    .    :
    151 TTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    155 TTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAGCA

    200     .    :    .    :    .    :    .    :    .    :
    201 AAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    205 AAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTCCT

    250     .    :    .    :    .    :    .    :    .    :
    251 ACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    255 ACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAA

    300     .    :    .    :    .    :    .    :    .    :
    301 TGTACTTC         CTTCTGGGTCTTGGGCATGTCGGTGTGGCGCTG
        ||||||||<<<...<<<|||||||||||||||||||||||||||||||||
    305 TGTACTTCCTA...TACCTTCTGGGTCTTGGGCATGTCGGTGTGGCGCTG

    350     .    :    .    :    .    :    .    :    .    :
    342 GGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAATACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17288 GGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAATACA

    400     .    :    .    :    .    :    .    :    .    :
    392 TCTCCAGCCTCCTTAGATCACAGCTCCGGAAGCAGCACTCATCCACGATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17338 TCTCCAGCCTCCTTAGATCACAGCTCCGGAAGCAGCACTCATCCACGATG

    450     .    :    .    :    .    :    .    :    .    :
    442 CCTGTCTGAGGCGCCCTCCGACTGCTGGAGCCATACCCTGTGGGCTTGT 
        |||||||||||||||||||||||||||||||||||||||||||||||||<
  17388 CCTGTCTGAGGCGCCCTCCGACTGCTGGAGCCATACCCTGTGGGCTTGTC

    500     .    :    .    :    .    :    .    :    .    :
    491         TGAAATAAAAGCCCCTGTCTTCACACACGAACTGAAGAGCAT
        <<...<<<|||||||||||||||||||| |||||||||||||||||||||
  17438 TG...TACTGAAATAAAAGCCCCTGTCTCCACACACGAACTGAAGAGCAT

    550     .    :    .    :    .    :    .    :    .
    533 NCACCAGCTCAGCCCCGCA AGCGTCTTC GTCCAGCCGTG CAGA
         ||||||||||||||||||-||||||| |-|||||||||||-||||
  73431 CCACCAGCTCAGCCCCGCAGAGCGTCTCCGGTCCAGCCGTGGCAGA

END