Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI289618.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI289618.1, 455 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|3932798|gb|AI289618.1|AI289618 qw29b05.x1 NCI_CGAP_Ut4 Homo sapiens cDNA clone IMAGE:1992465 3' similar to gb:M28668 CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR (HUMAN);, mRNA sequence
>ENSG00000001626

(complement)

1-455  (334-796)   96%

      0     .    :    .    :    .    :    .    :    .    :
      1 CAAATATAAAAATTATTTTATACAAATGTAATTCATAATCATTCTTTTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    334 CAAATATAAAAATTATTTTATACAAATGTAATTCATAATCATTCTTTTAA

     50     .    :    .    :    .    :    .    :    .    :
     51 AATACAGCATTGTTATATATGTTTGAAACATTATTAAAATAAATATTTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    384 AATACAGCATTGTTATATATGTTTGAAACATTATTAAAATAAATATTTCC

    100     .    :    .    :    .    :    .    :    .    :
    101 TAGAGAAAAAATTTTGCTTCACAAAATTATAAAACAGAAGCATATAAAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    434 TAGAGAAAAAATTTTGCTTCACAAAATTATAAAACAGAAGCATATAAAAC

    150     .    :    .    :    .    :    .    :    .    :
    151 TAATTCATGATTGGTGCTTCTTCAGTGTGTCTCTCATTCTCTCTTAGTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    484 TAATTCATGATTGGTGCTTCTTCAGTGTGTCTCTCATTCTCTCTTAGTGT

    200     .    :    .    :    .    :    .    :    .    :
    201 AGACAGCATGAAGTACATACATCTAGCCTGAAAACATACCACCATCAACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    534 AGACAGCATGAAGTACATACATCTAGCCTGAAAACATACCACCATCAACC

    250     .    :    .    :    .    :    .    :    .    :
    251 TATACATCTAAATGCTTGGACTTCATGTGTGTCTACCCACAGTGCCCATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    584 TATACATCTAAATGCTTGGACTTCATGTGTGTCTACCCACAGTGCCCATG

    300     .    :    .    :    .    :    .    :    .    :
    301 GCCTATCTACTTACACACCCTCTACCTGNAGCTTCTGTGNNAAGAAAGGC
        |||||||||||||||||||||||||||| ||||||||||  ||||| |||
    634 GCCTATCTACTTACACACCCTCTACCTGGAGCTTCTGTGGAAAGAAGGGC

    350     .    :    .    :    .    :    .    :    .    :
    351 TGGCCTGTGACATTTTGCACTAACATACTTTTTCAGCTAAACTTTAGTTC
        || ||||||||| ||||||||||||||||||| |||||||||| ||||||
    684 TGTCCTGTGACAATTTGCACTAACATACTTTTCCAGCTAAACTCTAGTTC

    400     .    :    .    :    .    :    .    :    .    :
    401 AAAG TCTGTGAGCT GGCACTTTCT GAGT GGGAAAA GCATAT AAC
        ||||-||||||||||-| ||||||||-||||-|||||||-||||||-|||
    734 AAAGGTCTGTGAGCTTGTCACTTTCTGGAGTTGGGAAAAGGCATATCAAC

    450     .    :
    445  TCTT ATCAAGG
        -||||-|||||||
    784 TTCTTCATCAAGG

END