Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI457887.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI457887.1, 326 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|4310768|gb|AI457887.1|AI457887 tj48a01.x1 Soares_NSF_F8_9W_OT_PA_P_S1 Homo sapiens cDNA clone IMAGE:2144712 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

218-241  (51045-51068)   83% ==
302-326  (53969-53993)   100%

      0     .    :    .    :
    218 GCTTTTTGTTTGTTTGTTTGTTTT
        ||||    ||||||||||||||||
  51045 GCTTGGCATTTGTTTGTTTGTTTT

      0     .    :    .    :    .
    302 TGTGTGTGTGTGTGTGTGTGTGTGT
        |||||||||||||||||||||||||
  53969 TGTGTGTGTGTGTGTGTGTGTGTGT

END