Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI478804.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI478804.1, 430 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|4373617|gb|AI478804.1|AI478804 tm52e04.x1 NCI_CGAP_Kid11 Homo sapiens cDNA clone IMAGE:2161758 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

1-307  (6-312)   100% <-
308-356  (15701-15749)   100% <-
357-430  (17255-17328)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 CTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCCAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      6 CTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCCAGGA

     50     .    :    .    :    .    :    .    :    .    :
     51 CCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGTTTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     56 CCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGTTTA

    100     .    :    .    :    .    :    .    :    .    :
    101 CTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAAACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    106 CTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAAACT

    150     .    :    .    :    .    :    .    :    .    :
    151 TATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAGCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    156 TATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAGCAA

    200     .    :    .    :    .    :    .    :    .    :
    201 AGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTCCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    206 AGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTCCTA

    250     .    :    .    :    .    :    .    :    .    :
    251 CATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    256 CATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAAT

    300     .    :    .    :    .    :    .    :    .    :
    301 GTACTTC         CTTTCCTTCTCTGAGACTTCGTGTTCTTGTTGGT
        |||||||<<<...<<<||||||||||||||||||||||||||||||||||
    306 GTACTTCCTA...AACCTTTCCTTCTCTGAGACTTCGTGTTCTTGTTGGT

    350     .    :    .    :    .    :    .    :    .    :
    342 AGATGGGGGCTGATA         CTTCTGGGTCTTGGGCATGTCGGTGT
        |||||||||||||||<<<...<<<||||||||||||||||||||||||||
  15735 AGATGGGGGCTGATACTG...TACCTTCTGGGTCTTGGGCATGTCGGTGT

    400     .    :    .    :    .    :    .    :    .
    383 GGCGCTGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||
  17281 GGCGCTGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTG

END