Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI609591.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI609591.1, 484 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|4618758|gb|AI609591.1|AI609591 tw28d03.x1 NCI_CGAP_Ov35 Homo sapiens cDNA clone IMAGE:2260997 3' similar to gb:M28668 CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR (HUMAN);, mRNA sequence
>ENSG00000001626

(complement)

1-19  (5135-5154)   95% <-
20-484  (127954-128418)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 TTTTTTTTTTTTTTTTTTA          AAGCATAATAAGTATTTATTT
        |||||||||||||||||||-<<<...<<<|||||||||||||||||||||
   5135 TTTTTTTTTTTTTTTTTTAGCTG...AAAAAGCATAATAAGTATTTATTT

     50     .    :    .    :    .    :    .    :    .    :
     41 GCTTCTTAATCATATACAAGTTTATCCAATTAGCTTTGTATAAATTGAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 127975 GCTTCTTAATCATATACAAGTTTATCCAATTAGCTTTGTATAAATTGAGT

    100     .    :    .    :    .    :    .    :    .    :
     91 CTTATCACTTGAAAACTTTAGAATTTCTCAAAGCTGCTAGCTACATCAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 128025 CTTATCACTTGAAAACTTTAGAATTTCTCAAAGCTGCTAGCTACATCAGT

    150     .    :    .    :    .    :    .    :    .    :
    141 ATTATTGGGATTTTAAGGTAATTTGGCATAAAATGCCACTCTCATCCATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 128075 ATTATTGGGATTTTAAGGTAATTTGGCATAAAATGCCACTCTCATCCATC

    200     .    :    .    :    .    :    .    :    .    :
    191 ATACTGTCCAGAGAAATGCTAGGAAAAGTTTAAGGTGAACATTCCTAGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 128125 ATACTGTCCAGAGAAATGCTAGGAAAAGTTTAAGGTGAACATTCCTAGTA

    250     .    :    .    :    .    :    .    :    .    :
    241 TTAGCTGGCAACTTTTATAACTTCCTAGNGAAGGAAATTTCTTTTTCTAT
        |||||||||||||||||||||||||||| |||||||||||||||||||||
 128175 TTAGCTGGCAACTTTTATAACTTCCTAGTGAAGGAAATTTCTTTTTCTAT

    300     .    :    .    :    .    :    .    :    .    :
    291 CTTTTCGCACATTTTTGCAAAGTTCATTAGAACTGATCTATTGACTGATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 128225 CTTTTCGCACATTTTTGCAAAGTTCATTAGAACTGATCTATTGACTGATT

    350     .    :    .    :    .    :    .    :    .    :
    341 ATTTAAATCATAGTATATAATGCAGCATTATGGTACATTACCTGTATTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 128275 ATTTAAATCATAGTATATAATGCAGCATTATGGTACATTACCTGTATTTT

    400     .    :    .    :    .    :    .    :    .    :
    391 GTTTATTGCTCCAAGAGAGTCATACCATGTTTGTACAGCCCAGGGAAATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 128325 GTTTATTGCTCCAAGAGAGTCATACCATGTTTGTACAGCCCAGGGAAATT

    450     .    :    .    :    .    :    .    :
    441 GCCGAGTGACCGCCATGCGCAGAACAATGCAGAATGAGATGGTG
        ||||||||||||||||||||||||||||||||||||||||||||
 128375 GCCGAGTGACCGCCATGCGCAGAACAATGCAGAATGAGATGGTG

END