Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI633655.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI633655.1, 652 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|4684985|gb|AI633655.1|AI633655 th70h08.x1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:2124063 3' similar to gb:X04434_cds1 INSULIN-LIKE GROWTH FACTOR I RECEPTOR PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000140443

3-128  (1-126)   100% ->
129-652  (58013-58538)   98%

      0     .    :    .    :    .    :    .    :    .    :
      3 GAGAAAGGGGAATTTCATCCCAAATAAAAGGAATGAAGTCTGGCTCCGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 GAGAAAGGGGAATTTCATCCCAAATAAAAGGAATGAAGTCTGGCTCCGGA

     50     .    :    .    :    .    :    .    :    .    :
     53 GGAGGGTCCCCGACCTCGCTGTGGGGGCTCCTGTTTCTCTCCGCCGCGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 GGAGGGTCCCCGACCTCGCTGTGGGGGCTCCTGTTTCTCTCCGCCGCGCT

    100     .    :    .    :    .    :    .    :    .    :
    103 CTCGCTCTGGCCGACGAGTGGAGAAA         TCTGCGGGCCAGGCA
        ||||||||||||||||||||||||||>>>...>>>|||||||||||||||
    101 CTCGCTCTGGCCGACGAGTGGAGAAAGTG...CAGTCTGCGGGCCAGGCA

    150     .    :    .    :    .    :    .    :    .    :
    144 TCGACATCCGCAACGACTATCAGCAGCTGAAGCGCCTGGAGAACTGCACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58028 TCGACATCCGCAACGACTATCAGCAGCTGAAGCGCCTGGAGAACTGCACG

    200     .    :    .    :    .    :    .    :    .    :
    194 GTGATCGAGGGCTACCTCCACATCCTGCTCATCTCCAAGGCCGAGGACTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58078 GTGATCGAGGGCTACCTCCACATCCTGCTCATCTCCAAGGCCGAGGACTA

    250     .    :    .    :    .    :    .    :    .    :
    244 CCGCAGCTACCGCTTCCCCAAGCTCACGGTCATTACCGAGTACTTGCTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58128 CCGCAGCTACCGCTTCCCCAAGCTCACGGTCATTACCGAGTACTTGCTGC

    300     .    :    .    :    .    :    .    :    .    :
    294 TGTTCCGAGTGGCTGGCCTCGAGAGCCTCGGAGACCTCTTCCCCAACCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58178 TGTTCCGAGTGGCTGGCCTCGAGAGCCTCGGAGACCTCTTCCCCAACCTC

    350     .    :    .    :    .    :    .    :    .    :
    344 ACGGTCATTCGCGGTTGGAAACTCTTCTACAACTACGCCCTGGTCATCTT
        |||||||| ||||| |||||||||||||||||||||||||||||||||||
  58228 ACGGTCATCCGCGGCTGGAAACTCTTCTACAACTACGCCCTGGTCATCTT

    400     .    :    .    :    .    :    .    :    .    :
    394 CGAGATGACCAATCTCAAGGATATTGGGCTTTACAACCTGAGGAACATTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58278 CGAGATGACCAATCTCAAGGATATTGGGCTTTACAACCTGAGGAACATTA

    450     .    :    .    :    .    :    .    :    .    :
    444 CTCGGGGGGCCATCAGGATTGAGAAAAATGCTGACCTCTGTTACCTCTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58328 CTCGGGGGGCCATCAGGATTGAGAAAAATGCTGACCTCTGTTACCTCTCC

    500     .    :    .    :    .    :    .    :    .    :
    494 ACTGTGGACTGGTCCCTGATCCTGGATGCGGTGTCCAATAACTACATTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58378 ACTGTGGACTGGTCCCTGATCCTGGATGCGGTGTCCAATAACTACATTGT

    550     .    :    .    :    .    :    .    :    .    :
    544 GGTGAATAAGCCCCCAAAGGAATGTGGAGACCTGTGTCCAGGGACCATGG
        || |||||||||||||||||||||||| ||||||||||||||||||||||
  58428 GGGGAATAAGCCCCCAAAGGAATGTGGGGACCTGTGTCCAGGGACCATGG

    600     .    :    .    :    .    :    .    :    .    :
    594 AGGAGATGCCGATGTGTGAGAAGA CACCATCA CAATGAGTACAACTAC
        |||||| |||||||||||||||||-||||||||-||||||||||||||||
  58478 AGGAGAAGCCGATGTGTGAGAAGACCACCATCAACAATGAGTACAACTAC

    650     .    :
    642 CGCTGCTGGAC
        |||||||||||
  58528 CGCTGCTGGAC

END