Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI688703.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI688703.1, 806 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|4899997|gb|AI688703.1|AI688703 wd40e01.x1 Soares_NFL_T_GBC_S1 Homo sapiens cDNA clone IMAGE:2330616 3' similar to gb:M28668 CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR (HUMAN);, mRNA sequence
>ENSG00000001626

(complement)

4-806  (1-801)   98%

      0     .    :    .    :    .    :    .    :    .    :
      4 ACACAAATGTATGGATTTTATTGACAAGTGATATTTTCTTACAGTAATAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 ACACAAATGTATGGATTTTATTGACAAGTGATATTTTCTTACAGTAATAA

     50     .    :    .    :    .    :    .    :    .    :
     54 ATATAATGCAGTCTTCTTAAGAGTCAGTTTGGAGTTGAGAAGGCAGTGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 ATATAATGCAGTCTTCTTAAGAGTCAGTTTGGAGTTGAGAAGGCAGTGTA

    100     .    :    .    :    .    :    .    :    .    :
    104 CCCTTGATGGAAACAGTCAGACTGGTGGTACCATCTTCTTCAGAACTGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 CCCTTGATGGAAACAGTCAGACTGGTGGTACCATCTTCTTCAGAACTGCA

    150     .    :    .    :    .    :    .    :    .    :
    154 TCTAAGAGGCTGTGCTGGCTGGGAATCATACAGCTGTGGGCAACAACTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    151 TCTAAGAGGCTGTGCTGGCTGGGAATCATACAGCTGTGGGCAACAACTGC

    200     .    :    .    :    .    :    .    :    .    :
    204 ATCAGCCCCAAGGCTTCCCTCCAGACCAAAAGGTGATTCATGGCCCCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 ATCAGCCCCAAGGCTTCCCTCCAGACCAAAAGGTGATTCATGGCCCCTGG

    250     .    :    .    :    .    :    .    :    .    :
    254 TTAATATCACCCTAGGTTCTCCCCTGTCCCAGTTTTAACATAATATTTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    251 TTAATATCACCCTAGGTTCTCCCCTGTCCCAGTTTTAACATAATATTTCA

    300     .    :    .    :    .    :    .    :    .    :
    304 TAGAAATACTAGTGCCATAAAAAGTCAATATTTCAAATATAAAAATTATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    301 TAGAAATACTAGTGCCATAAAAAGTCAATATTTCAAATATAAAAATTATT

    350     .    :    .    :    .    :    .    :    .    :
    354 TTATACAAATGTAATTCATAATCATTCTTTTAAAATACAGCATTGTTATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    351 TTATACAAATGTAATTCATAATCATTCTTTTAAAATACAGCATTGTTATA

    400     .    :    .    :    .    :    .    :    .    :
    404 TATGTTTGAAACATTATTAAAATAAATATTTCCTAGAGAAAAAATTTTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    401 TATGTTTGAAACATTATTAAAATAAATATTTCCTAGAGAAAAAATTTTGC

    450     .    :    .    :    .    :    .    :    .    :
    454 TTCACAAAATTATAAAACAGAAGCATATAAAACTAATTCATGATTGGTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    451 TTCACAAAATTATAAAACAGAAGCATATAAAACTAATTCATGATTGGTGC

    500     .    :    .    :    .    :    .    :    .    :
    504 TTCTTCAGTGTGTCTCTCATTCTCTCTTAGTGTAGACAGCATGAAGTACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    501 TTCTTCAGTGTGTCTCTCATTCTCTCTTAGTGTAGACAGCATGAAGTACA

    550     .    :    .    :    .    :    .    :    .    :
    554 TACATCTAGCCTGAAAACATACCACCATCAACCTATACATCTNAATGCTT
        |||||||||||||||||||||||||||||||||||||||||| |||||||
    551 TACATCTAGCCTGAAAACATACCACCATCAACCTATACATCTAAATGCTT

    600     .    :    .    :    .    :    .    :    .    :
    604 GGACTTCATGTGTGTCTACCCACAGTGCCCATGGGCTATCTACTTACACA
        |||||||||||||||||||||||||||||||||| |||||||||||||||
    601 GGACTTCATGTGTGTCTACCCACAGTGCCCATGGCCTATCTACTTACACA

    650     .    :    .    :    .    :    .    :    .    :
    654 NCCTCTACCTGGAGCTTCTGTGGAAAGAAGGGCTGTC TGTGACCATTTG
         ||||||||||||||||||||||||||||||||||||-|||||| |||||
    651 CCCTCTACCTGGAGCTTCTGTGGAAAGAAGGGCTGTCCTGTGACAATTTG

    700     .    :    .    :    .    :    .    :    .    :
    703 CACTAACATACTTTTCCAGCTAAACTCTAGTTCAAAAGTCTGTGAGCTTG
        |||||||||||||||||||||||||||||||||||| |||||||||||||
    701 CACTAACATACTTTTCCAGCTAAACTCTAGTTCAAAGGTCTGTGAGCTTG

    750     .    :    .    :    .    :    .    :    .    :
    753 GCACTTTCCTGGGAGTGGGGAAAAGGCATATCACCCTTCTTCATTAAGGG
         |||||||-|||-||| |||||||||||||||| |-|||||||| |||||
    751 TCACTTTC TGG AGTTGGGAAAAGGCATATCAAC TTCTTCATCAAGGG

    800 
    803 GACC
         |||
    798 AACC

END