Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI761358.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI761358.1, 797 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|5177025|gb|AI761358.1|AI761358 wi60f01.x1 NCI_CGAP_Co16 Homo sapiens cDNA clone IMAGE:2394649 3' similar to gb:M28668 CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR (HUMAN);, mRNA sequence
>ENSG00000001626

(complement)

1-797  (1-800)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 ACACAAATGTATG TTATTTATTGACAAGTGATATTTTCTTACAGGGATA
        |||||||||||||- |-||||||||||||||||||||||||||||  |||
      1 ACACAAATGTATGGAT TTTATTGACAAGTGATATTTTCTTACAGTAATA

     50     .    :    .    :    .    :    .    :    .    :
     50 AATATAATGCAGTCTTCTTAAGAGTCAGTTTGGAGTTGAGAAGGCAGTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     50 AATATAATGCAGTCTTCTTAAGAGTCAGTTTGGAGTTGAGAAGGCAGTGT

    100     .    :    .    :    .    :    .    :    .    :
    100 ACCCTTGATGGAAACAGTCAGACTGGTGGTACCATCTTCTTCAGAACTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    100 ACCCTTGATGGAAACAGTCAGACTGGTGGTACCATCTTCTTCAGAACTGC

    150     .    :    .    :    .    :    .    :    .    :
    150 ATCTAAGAGGCTGTGCTGGCTGGGAATCATACAGCTGTGGGCAACAACTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    150 ATCTAAGAGGCTGTGCTGGCTGGGAATCATACAGCTGTGGGCAACAACTG

    200     .    :    .    :    .    :    .    :    .    :
    200 CATCAGCCCCAAGGCTTCCCTCCAGACCAAAAGGTGATTCATGGCCCCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    200 CATCAGCCCCAAGGCTTCCCTCCAGACCAAAAGGTGATTCATGGCCCCTG

    250     .    :    .    :    .    :    .    :    .    :
    250 GTTAATATCACCCTAGGTTCTTCCCTGGCCCAGTTTT ACATAATATTTC
        ||||||||||||||||||||| ||||| |||||||||-||||||||||||
    250 GTTAATATCACCCTAGGTTCTCCCCTGTCCCAGTTTTAACATAATATTTC

    300     .    :    .    :    .    :    .    :    .    :
    299 ATAGAAATACTAGTGCCATAAAAAGTCAATATTTCAAATATAAAAATTAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    300 ATAGAAATACTAGTGCCATAAAAAGTCAATATTTCAAATATAAAAATTAT

    350     .    :    .    :    .    :    .    :    .    :
    349 TTTATACAAATGTAATTCATAATCATTCTTTTAAAATACAGCATTGTTAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    350 TTTATACAAATGTAATTCATAATCATTCTTTTAAAATACAGCATTGTTAT

    400     .    :    .    :    .    :    .    :    .    :
    399 ATATGTTTGAAACATTATTAAAATAAATATTTCCTAGAGAAAAAATTTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    400 ATATGTTTGAAACATTATTAAAATAAATATTTCCTAGAGAAAAAATTTTG

    450     .    :    .    :    .    :    .    :    .    :
    449 CTTCACAAAATTATAAAACAGAAGCATATAAAACTAATTCATGATTGGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    450 CTTCACAAAATTATAAAACAGAAGCATATAAAACTAATTCATGATTGGTG

    500     .    :    .    :    .    :    .    :    .    :
    499 CTTCTTCAGTGTGTCTCTCATTCTCTCTTAGTGTAGACAGCATGAAGTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    500 CTTCTTCAGTGTGTCTCTCATTCTCTCTTAGTGTAGACAGCATGAAGTAC

    550     .    :    .    :    .    :    .    :    .    :
    549 ATACATCTAGCCTGAAAACATACCACCATCAACCTATACATCTAAATGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    550 ATACATCTAGCCTGAAAACATACCACCATCAACCTATACATCTAAATGCT

    600     .    :    .    :    .    :    .    :    .    :
    599 TGGACTTCATGTGTGTCTACCCACAGTGCCCATGGCCTATCTACTTACAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    600 TGGACTTCATGTGTGTCTACCCACAGTGCCCATGGCCTATCTACTTACAC

    650     .    :    .    :    .    :    .    :    .    :
    649 ACNCTCTACCTGGAGCTTNTGTGGAAAGAAGGGCTGTCCTGTGANCATTT
        || ||||||||||||||| |||||||||||||||||||||||||  ||||
    650 ACCCTCTACCTGGAGCTTCTGTGGAAAGAAGGGCTGTCCTGTGACAATTT

    700     .    :    .    :    .    :    .    :    .    :
    699 GCACTAACATACTTTTNCAGCTAAACTCTAGTTCANAGGTCTGTGAGCTT
        |||||||||||||||| |||||||||||||||||| ||||||||||||||
    700 GCACTAACATACTTTTCCAGCTAAACTCTAGTTCAAAGGTCTGTGAGCTT

    750     .    :    .    :    .    :    .    :    .    :
    749 GTCACTTTCTTGAGTTGGGAAA GGCATATCAACTTCT CATCAAGGAAA
        |||||||||| |||||||||||-|||||||||||||||-|||||||| ||
    750 GTCACTTTCTGGAGTTGGGAAAAGGCATATCAACTTCTTCATCAAGGGAA

    800 
    797 C
        |
    800 C

END