Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI769767.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI769767.1, 365 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|5236276|gb|AI769767.1|AI769767 wj26c10.x1 NCI_CGAP_Kid12 Homo sapiens cDNA clone IMAGE:2403954 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

1-249  (64-312)   100% <-
250-365  (17255-17369)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 GCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGTTTACTTGTGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     64 GCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGTTTACTTGTGTA

     50     .    :    .    :    .    :    .    :    .    :
     51 TTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAAACTTATTTTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    114 TTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAAACTTATTTTTT

    100     .    :    .    :    .    :    .    :    .    :
    101 GGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAGCAAAGGATCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    164 GGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAGCAAAGGATCCT

    150     .    :    .    :    .    :    .    :    .    :
    151 GCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTCCTACATCCTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    214 GCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTCCTACATCCTGT

    200     .    :    .    :    .    :    .    :    .    :
    201 AGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAATGTACTTC 
        |||||||||||||||||||||||||||||||||||||||||||||||||<
    264 AGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAATGTACTTCC

    250     .    :    .    :    .    :    .    :    .    :
    250         CTTTCTGGGTCTTGGGCATGTCGGTGTGGCGCTGGGCACGGA
        <<...<<<|||-||||||||||||||||||||||||||||||||||||||
    314 TA...TACCTT CTGGGTCTTGGGCATGTCGGTGTGGCGCTGGGCACGGA

    300     .    :    .    :    .    :    .    :    .    :
    292 CAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAATACATCTCCAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17296 CAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAATACATCTCCAGC

    350     .    :    .    :
    342 CTCCTTAGATCACAGCTCCGGAAG
        ||||||||||||||||||||||||
  17346 CTCCTTAGATCACAGCTCCGGAAG

END