Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI813766.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI813766.1, 790 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|5424981|gb|AI813766.1|AI813766 wk79c06.x1 NCI_CGAP_Pan1 Homo sapiens cDNA clone IMAGE:2421610 3' similar to gb:M28668 CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR (HUMAN);, mRNA sequence
>ENSG00000001626

(complement)

9-790  (1-784)   98%

      0     .    :    .    :    .    :    .    :    .    :
      9 ACACAAATGTATGGATTTTATTGACAAGTGATATTTTCTTACAGTAATAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 ACACAAATGTATGGATTTTATTGACAAGTGATATTTTCTTACAGTAATAA

     50     .    :    .    :    .    :    .    :    .    :
     59 ATATAATGCAGTCTTCTTAAGAGTCAGTTTGGAGTTGAAAAGGCAGTGTA
        |||||||||||||||||||||||||||||||||||||| |||||||||||
     51 ATATAATGCAGTCTTCTTAAGAGTCAGTTTGGAGTTGAGAAGGCAGTGTA

    100     .    :    .    :    .    :    .    :    .    :
    109 CCCTTGATGGAAACAGTCAAACTGGTGGTACCATCTTCTTCAGAACTGCA
        ||||||||||||||||||| ||||||||||||||||||||||||||||||
    101 CCCTTGATGGAAACAGTCAGACTGGTGGTACCATCTTCTTCAGAACTGCA

    150     .    :    .    :    .    :    .    :    .    :
    159 TCTAAAAGGCTGTGCTGGCTGGGAATCATACAGCTGTGGGCAACAACTGC
        ||||| ||||||||||||||||||||||||||||||||||||||||||||
    151 TCTAAGAGGCTGTGCTGGCTGGGAATCATACAGCTGTGGGCAACAACTGC

    200     .    :    .    :    .    :    .    :    .    :
    209 ATCAGCCCCAAGGCTTCCCTCCAGACCAAAAGGTGATTCATGGCCCCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 ATCAGCCCCAAGGCTTCCCTCCAGACCAAAAGGTGATTCATGGCCCCTGG

    250     .    :    .    :    .    :    .    :    .    :
    259 TTAATATCACCCTAGGTTCTCCCCTGTCCCAGTTTTAACATAATATTTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    251 TTAATATCACCCTAGGTTCTCCCCTGTCCCAGTTTTAACATAATATTTCA

    300     .    :    .    :    .    :    .    :    .    :
    309 TAGAAATACTAGTGCCATAAAAAGTCAATATTTCAAATATAAAAATTATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    301 TAGAAATACTAGTGCCATAAAAAGTCAATATTTCAAATATAAAAATTATT

    350     .    :    .    :    .    :    .    :    .    :
    359 TTATACAAATGTAATTCATAATCATTCTTTTAAAATACAGCATTGTTATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    351 TTATACAAATGTAATTCATAATCATTCTTTTAAAATACAGCATTGTTATA

    400     .    :    .    :    .    :    .    :    .    :
    409 TATGTTTGAAACATTATTAAAATAAATATTTCCTAGAGAAAAAATTTTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    401 TATGTTTGAAACATTATTAAAATAAATATTTCCTAGAGAAAAAATTTTGC

    450     .    :    .    :    .    :    .    :    .    :
    459 TTCACAAAATTATAAAACAGAAGCATATAAAACTAATTCATGATTGGTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    451 TTCACAAAATTATAAAACAGAAGCATATAAAACTAATTCATGATTGGTGC

    500     .    :    .    :    .    :    .    :    .    :
    509 TTCTTCAGTGTGTCTCTCATTCTCTCTTAGTGTAGACAGCATGAAGTACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    501 TTCTTCAGTGTGTCTCTCATTCTCTCTTAGTGTAGACAGCATGAAGTACA

    550     .    :    .    :    .    :    .    :    .    :
    559 TACATCTAGCCTGAAAACATACCACCATCAACCTATACATCTAAGTGCTT
        |||||||||||||||||||||||||||||||||||||||||||| |||||
    551 TACATCTAGCCTGAAAACATACCACCATCAACCTATACATCTAAATGCTT

    600     .    :    .    :    .    :    .    :    .    :
    609 GNACTTCATGTGTGTCTACCCACAGTGCCCATGGCCTATCTACTTACACA
        | ||||||||||||||||||||||||||||||||||||||||||||||||
    601 GGACTTCATGTGTGTCTACCCACAGTGCCCATGGCCTATCTACTTACACA

    650     .    :    .    :    .    :    .    :    .    :
    659 CCCTCTACCTGNAGCTTCTGTGGAAAGAGGGGCTGTCCTGTGACAAATTG
        ||||||||||| |||||||||||||||| ||||||||||||||||| |||
    651 CCCTCTACCTGGAGCTTCTGTGGAAAGAAGGGCTGTCCTGTGACAATTTG

    700     .    :    .    :    .    :    .    :    .    :
    709 CACTAACATACTTTTCCAGCGTAACTCTAGTTCAAAG TCTGTGAGCTTG
        ||||||||||||||||||||  |||||||||||||||-||||||||||||
    701 CACTAACATACTTTTCCAGCTAAACTCTAGTTCAAAGGTCTGTGAGCTTG

    750     .    :    .    :    .    :
    758 TCACTTNCTGGAGTTGG AAAAGGGCTATCAACT
        |||||| ||||||||||-||||||  ||||||||
    751 TCACTTTCTGGAGTTGGGAAAAGGCATATCAACT

END