Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI829360.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI829360.1, 700 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|5450031|gb|AI829360.1|AI829360 wk64a08.x1 NCI_CGAP_Pan1 Homo sapiens cDNA clone IMAGE:2420150 3' similar to gb:M28668 CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR (HUMAN);, mRNA sequence
>ENSG00000001626

(complement)

11-700  (1-691)   98%

      0     .    :    .    :    .    :    .    :    .    :
     11 ACACAAATGTATGGATTTTATTGACAAGTGATATTTTCTTACAGTAATAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 ACACAAATGTATGGATTTTATTGACAAGTGATATTTTCTTACAGTAATAA

     50     .    :    .    :    .    :    .    :    .    :
     61 ATATAATGCAGTCTTCTTAAGAGTCAGTTTGGAGTTGAGAAGGCAGTGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 ATATAATGCAGTCTTCTTAAGAGTCAGTTTGGAGTTGAGAAGGCAGTGTA

    100     .    :    .    :    .    :    .    :    .    :
    111 CCCTTGATGGAAACAGTCAGACTGGTGGTACCATCTTCTTCAGAACTGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 CCCTTGATGGAAACAGTCAGACTGGTGGTACCATCTTCTTCAGAACTGCA

    150     .    :    .    :    .    :    .    :    .    :
    161 TCTAAGAGGCTGTGCTGGCTGGGAATCATACAGCTGTGGGCAACAACTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    151 TCTAAGAGGCTGTGCTGGCTGGGAATCATACAGCTGTGGGCAACAACTGC

    200     .    :    .    :    .    :    .    :    .    :
    211 ATCAGCCCCAAGGCTTCCCTCCAGACCAAAAGGTGATTCATGGCCCCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 ATCAGCCCCAAGGCTTCCCTCCAGACCAAAAGGTGATTCATGGCCCCTGG

    250     .    :    .    :    .    :    .    :    .    :
    261 TTTAATATNACCCTAGGTTCTCCCCTGTCCCAGTTTTAACATAATATTTC
        ||-||||| |||||||||||||||||||||||||||||||||||||||||
    251 TT AATATCACCCTAGGTTCTCCCCTGTCCCAGTTTTAACATAATATTTC

    300     .    :    .    :    .    :    .    :    .    :
    311 ATAAAAATACTAGTGCCATAAAAAGTCAATATTTCAAATATAAAAATTAT
        ||| ||||||||||||||||||||||||||||||||||||||||||||||
    300 ATAGAAATACTAGTGCCATAAAAAGTCAATATTTCAAATATAAAAATTAT

    350     .    :    .    :    .    :    .    :    .    :
    361 TTTATACAAATGTAATTCATAATCATTCTTTTAAAATACAGCATTGTTAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    350 TTTATACAAATGTAATTCATAATCATTCTTTTAAAATACAGCATTGTTAT

    400     .    :    .    :    .    :    .    :    .    :
    411 ATATGTTGGAAACATTATTAAAATAAATATTTCCTAGAGAAAAAATTTTG
        ||||||| ||||||||||||||||||||||||||||||||||||||||||
    400 ATATGTTTGAAACATTATTAAAATAAATATTTCCTAGAGAAAAAATTTTG

    450     .    :    .    :    .    :    .    :    .    :
    461 CTTCACAAAATTATAAAACAGAAGCATATAAAACTAATTCATGATTGGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    450 CTTCACAAAATTATAAAACAGAAGCATATAAAACTAATTCATGATTGGTG

    500     .    :    .    :    .    :    .    :    .    :
    511 CTTCTTCAGTGTGTCTCTCATTCTCTCTTAGTGTAGACAGCATGAAGTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    500 CTTCTTCAGTGTGTCTCTCATTCTCTCTTAGTGTAGACAGCATGAAGTAC

    550     .    :    .    :    .    :    .    :    .    :
    561 ATACATCTAGCCTGAAA CATACCACCATCAACCTATACATCTAAATGCT
        |||||||||||||||||-||||||||||||||||||||||||||||||||
    550 ATACATCTAGCCTGAAAACATACCACCATCAACCTATACATCTAAATGCT

    600     .    :    .    :    .    :    .    :    .    :
    610 TGGAGCTCATGTGTGTCTACCCACAGTGGCCATGGCCTATCTACTTACAC
        ||||  |||||||||||||||||||||| |||||||||||||||||||||
    600 TGGACTTCATGTGTGTCTACCCACAGTGCCCATGGCCTATCTACTTACAC

    650     .    :    .    :    .    :    .    :
    660 ACCCTCTACCTGGAGCTTCTGTGGAAAGA GGGCTGCCCTGT
        |||||||||||||||||||||||||||||-|||||| |||||
    650 ACCCTCTACCTGGAGCTTCTGTGGAAAGAAGGGCTGTCCTGT

END