Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI865207.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI865207.1, 380 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|5529314|gb|AI865207.1|AI865207 wk09f02.x1 NCI_CGAP_Lym12 Homo sapiens cDNA clone IMAGE:2411835 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

24-242  (94-312)   97% <-
243-380  (17255-17390)   98%

      0     .    :    .    :    .    :    .    :    .    :
     24 TTGGAAGGTTAACTTGGGTATTTCATTGGGGGAAACGCCCATCTTTTAAA
        |||||| ||| ||||| |||||||||||||||||||||||||||||||||
     94 TTGGAATGTTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAA

     50     .    :    .    :    .    :    .    :    .    :
     74 TGTTATCAAACTTATTTTTTGGTAGGGGTTCCAAAGTTTAACAGGTAACT
        |||||||||||||||||||||||||| |||||||||||||||||||||||
    144 TGTTATCAAACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACT

    100     .    :    .    :    .    :    .    :    .    :
    124 CGTGCAGAGCAAAGGATCCTGCGGGGGCATGTCACTCTTCACTCCTCAGG
        |||||||||||||||||||||||| |||||||||||||||||||||||||
    194 CGTGCAGAGCAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGG

    150     .    :    .    :    .    :    .    :    .    :
    174 AGGGTCTTCCTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    244 AGGGTCTTCCTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTG

    200     .    :    .    :    .    :    .    :    .    :
    224 CGTTCTTCAAATGTACTTC         CTTCTGGGTCTTGGGCATGTCG
        |||||||||||||||||||<<<...<<<||||||||||||||||||||||
    294 CGTTCTTCAAATGTACTTCCTA...TACCTTCTGGGTCTTGGGCATGTCG

    250     .    :    .    :    .    :    .    :    .    :
    265 GTGTGGCGCTGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17277 GTGTGGCGCTGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGG

    300     .    :    .    :    .    :    .    :    .    :
    315 GTGCGCAATACATCTCCAGCCTCCTTAGATCACAGCTCCCGGAAGCAGCA
        -||||||||||||||||||||||||||||||||||||||-||||||||||
  17327  TGCGCAATACATCTCCAGCCTCCTTAGATCACAGCTCC GGAAGCAGCA

    350     .    :    .
    365 CTCATCCACGATGCCT
        ||||||||||||||||
  17375 CTCATCCACGATGCCT

END