Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI890417.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI890417.1, 755 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|5595581|gb|AI890417.1|AI890417 wm85a11.x1 NCI_CGAP_Ut2 Homo sapiens cDNA clone IMAGE:2442716 3' similar to gb:M28668 CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR (HUMAN);, mRNA sequence
>ENSG00000001626

(complement)

11-755  (1-745)   97%

      0     .    :    .    :    .    :    .    :    .    :
     11 ACACAAATGTATGGATTTTATTGACAAGTGATATTTTCTTACAGTAATAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 ACACAAATGTATGGATTTTATTGACAAGTGATATTTTCTTACAGTAATAA

     50     .    :    .    :    .    :    .    :    .    :
     61 ATATAATGCAGTCTTCTTAAAAGTCAGTTTGGAGTTGAAAAGGCAGTGTA
        |||||||||||||||||||| ||||||||||||||||| |||||||||||
     51 ATATAATGCAGTCTTCTTAAGAGTCAGTTTGGAGTTGAGAAGGCAGTGTA

    100     .    :    .    :    .    :    .    :    .    :
    111 CCCTTGATGGAAACAGTCAGACTGGTGGTACCATCTTCTTCAAAACTGCA
        |||||||||||||||||||||||||||||||||||||||||| |||||||
    101 CCCTTGATGGAAACAGTCAGACTGGTGGTACCATCTTCTTCAGAACTGCA

    150     .    :    .    :    .    :    .    :    .    :
    161 TCTAAAAGGCTGTGCTGGCTGGGAATCATACAGCTGTGGGCAACAACTGC
        ||||| ||||||||||||||||||||||||||||||||||||||||||||
    151 TCTAAGAGGCTGTGCTGGCTGGGAATCATACAGCTGTGGGCAACAACTGC

    200     .    :    .    :    .    :    .    :    .    :
    211 ATCAGCCCCAAGGCTTCCCTCCAGACCAAAAGGTGATTCATGGCCCCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    201 ATCAGCCCCAAGGCTTCCCTCCAGACCAAAAGGTGATTCATGGCCCCTGG

    250     .    :    .    :    .    :    .    :    .    :
    261 TTAATATCACCCTAGGTTCTCCCCTGTCCCAGTTTTAACATAATATTTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    251 TTAATATCACCCTAGGTTCTCCCCTGTCCCAGTTTTAACATAATATTTCA

    300     .    :    .    :    .    :    .    :    .    :
    311 TAGAAATACTAGTGCCATAAAAAGTCAATATTTCAAATATAAAAATTATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    301 TAGAAATACTAGTGCCATAAAAAGTCAATATTTCAAATATAAAAATTATT

    350     .    :    .    :    .    :    .    :    .    :
    361 TTATACAAATGTAATTCATAATCATTCTTTTAAAATACAGCATTGTTATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    351 TTATACAAATGTAATTCATAATCATTCTTTTAAAATACAGCATTGTTATA

    400     .    :    .    :    .    :    .    :    .    :
    411 TATGTTTGAAACATTATTAAAATAAATATTTCCTAGAGAAAAAATTTTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    401 TATGTTTGAAACATTATTAAAATAAATATTTCCTAGAGAAAAAATTTTGC

    450     .    :    .    :    .    :    .    :    .    :
    461 TTCACAAAATTATAAAACAGAAGCATATAAAACTAATTCATGATTGGTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    451 TTCACAAAATTATAAAACAGAAGCATATAAAACTAATTCATGATTGGTGC

    500     .    :    .    :    .    :    .    :    .    :
    511 TTCTTCANTGTGTCTCTCATTCTCTCTTA TGTAGACAGCATGAAGTACA
        ||||||| |||||||||||||||||||||-||||||||||||||||||||
    501 TTCTTCAGTGTGTCTCTCATTCTCTCTTAGTGTAGACAGCATGAAGTACA

    550     .    :    .    :    .    :    .    :    .    :
    560 TACATCTAGCCTGAANACATACCACCATCAACCTATACATCTAAATGCNT
        ||||||||||||||| ||||||||||||||||||||||||||||||||-|
    551 TACATCTAGCCTGAAAACATACCACCATCAACCTATACATCTAAATGC T

    600     .    :    .    :    .    :    .    :    .    :
    610 TGGACTTCATGT TGTCTACCCACAGTGCCCATGGCCTATCTACTTACAC
        ||||||||||||-|||||||||||||||||||||||||||||||||||||
    600 TGGACTTCATGTGTGTCTACCCACAGTGCCCATGGCCTATCTACTTACAC

    650     .    :    .    :    .    :    .    :    .    :
    659 ACCCCTCTACCTGGAGCTTCTGTGAAAAGAAAGGCTGT CTGTGACAAAT
        ||||-||||||||||||||||||| |||||| ||||||-||||||||| |
    650 ACCC TCTACCTGGAGCTTCTGTGGAAAGAAGGGCTGTCCTGTGACAATT

    700     .    :    .    :    .    :    .    :    .
    708 TGCACTAACATACTTTTTCAGCTAANACT TAGTTTCAAAGGTCTGTGA
        ||||||||||||||||| |||||||-|||-|||||-|||||||||||||
    699 TGCACTAACATACTTTTCCAGCTAA ACTCTAGTT CAAAGGTCTGTGA

END