Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI934593.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI934593.1, 708 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|5673390|gb|AI934593.1|AI934593 wp09h03.x1 NCI_CGAP_Kid12 Homo sapiens cDNA clone IMAGE:2464373 3' similar to gb:M28668 CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR (HUMAN);, mRNA sequence
>ENSG00000001626

(complement)

1-708  (3-712)   94%

      0     .    :    .    :    .    :    .    :    .    :
      1 ACAAATGTTTGGATTTTATTGACAAGTGATATTTTGTTACAGTAATAAAT
        |||||||| |||||||||||||||||||||||||| ||||||||||||||
      3 ACAAATGTATGGATTTTATTGACAAGTGATATTTTCTTACAGTAATAAAT

     50     .    :    .    :    .    :    .    :    .    :
     51 ATAATGCAGTCTTCTTAAAAGTCAGTTTGGAGTTGAAAAGGCAGCGTACC
        |||||||||||||||||| ||||||||||||||||| ||||||| |||||
     53 ATAATGCAGTCTTCTTAAGAGTCAGTTTGGAGTTGAGAAGGCAGTGTACC

    100     .    :    .    :    .    :    .    :    .    :
    101 CTTGATGGAAACAGTCAGACTGGTGGTCCCATCTTCTTCAGAACTGCATT
        ||||||||||||||||||||||||||| ||||||||||||||||||||| 
    103 CTTGATGGAAACAGTCAGACTGGTGGTACCATCTTCTTCAGAACTGCATC

    150     .    :    .    :    .    :    .    :    .    :
    151 TAATAGGCTGTGCTGGCTGGGAATCATTCAGCTGTGGGCAACAACTGCAT
        ||| ||||||||||||||||||||||| ||||||||||||||||||||||
    153 TAAGAGGCTGTGCTGGCTGGGAATCATACAGCTGTGGGCAACAACTGCAT

    200     .    :    .    :    .    :    .    :    .    :
    201 CAGCCCCAAGGCTTCCCTCCAGACCAAAAGGTGATTCATGGCCCCTGGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    203 CAGCCCCAAGGCTTCCCTCCAGACCAAAAGGTGATTCATGGCCCCTGGTT

    250     .    :    .    :    .    :    .    :    .    :
    251 AATATCACCCTAGGTTCTCCCCTGTCCCAGTTTTAACATACTATTGCATA
        |||||||||||||||||||||||||||||||||||||||| |||| ||||
    253 AATATCACCCTAGGTTCTCCCCTGTCCCAGTTTTAACATAATATTTCATA

    300     .    :    .    :    .    :    .    :    .    :
    301 GAAATACTAGGGCCATAAAAAGCCAATATTTCAAATATAAAAGTTATTTT
        |||||||||| ||||||||||| ||||||||||||||||||| |||||||
    303 GAAATACTAGTGCCATAAAAAGTCAATATTTCAAATATAAAAATTATTTT

    350     .    :    .    :    .    :    .    :    .    :
    351 ATACAAATGCAATTCATAATCATTCTTTTAAAATACAGCCTTGTTATATA
        ||||||||| ||||||||||||||||||||||||||||| ||||||||||
    353 ATACAAATGTAATTCATAATCATTCTTTTAAAATACAGCATTGTTATATA

    400     .    :    .    :    .    :    .    :    .    :
    401 TGTGTGAAACATTATGAAAATAAATATTTCCTAGAGAAAAAATTGTGCTT
        ||| ||||||||||| |||||||||||||||||||||||||||| |||||
    403 TGTTTGAAACATTATTAAAATAAATATTTCCTAGAGAAAAAATTTTGCTT

    450     .    :    .    :    .    :    .    :    .    :
    451 CACAATATTATACAACAGACGCATATACATCTAATTCATGATTGCTGCTT
        ||||| |||||| |||||| ||||||| | |||||||||||||| |||||
    453 CACAAAATTATAAAACAGAAGCATATAAAACTAATTCATGATTGGTGCTT

    500     .    :    .    :    .    :    .    :    .    :
    501 CATCAGTGTGTCTCTCATTCTCTCTTAGTGTAGACAGCATGAAGTACATA
        | ||||||||||||||||||||||||||||||||||||||||||||||||
    503 CTTCAGTGTGTCTCTCATTCTCTCTTAGTGTAGACAGCATGAAGTACATA

    550     .    :    .    :    .    :    .    :    .    :
    551 CATATAGCTCTG TAACATACCATCATGCACCTATACATCTAAATGCTTG
        ||| ||||-|||- ||||||||| |||  |||||||||||||||||||||
    553 CATCTAGC CTGAAAACATACCACCATCAACCTATACATCTAAATGCTTG

    600     .    :    .    :    .    :    .    :    .    :
    600 TACTTGATGTGTGTCTACCCACAGTGCACATGGCCTATCTACTTACACAC
         |||| ||||||||||||||||||||| ||||||||||||||||||||||
    602 GACTTCATGTGTGTCTACCCACAGTGCCCATGGCCTATCTACTTACACAC

    650     .    :    .    :    .    :    .    :    .    :
    650 ACTCTACCTGGAGCTTCTGTGGAAAGAAGGGCTG CCTGTGACA TGTTG
         |||||||||||||||||||||||||||||||||-|||||||||-|-|||
    652 CCTCTACCTGGAGCTTCTGTGGAAAGAAGGGCTGTCCTGTGACAAT TTG

    700     .    :
    698  ACTAGCATACT
        -|||| ||||||
    701 CACTAACATACT

END