Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AI990099.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AI990099.1, 522 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|5836980|gb|AI990099.1|AI990099 ws29b04.x1 NCI_CGAP_GC6 Homo sapiens cDNA clone IMAGE:2498575 3' similar to gb:M28668 CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR (HUMAN);, mRNA sequence
>ENSG00000001626

(complement)

1-24  (6657-6680)   91% ->
25-407  (40758-41140)   99% <-
408-510  (53949-54051)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 TTTTTTTTTTTTTTTTTTTATTAA         AACATGTGTGTTTAATA
        ||||||||||||||||||| || |>>>...>>>|||||||||||||||||
   6657 TTTTTTTTTTTTTTTTTTTTTTCAGTA...TAAAACATGTGTGTTTAATA

     50     .    :    .    :    .    :    .    :    .    :
     42 TTGATTCTACTGTACAATAATAATGTTACAAATAGATTCTGCTAACACAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  40775 TTGATTCTACTGTACAATAATAATGTTACAAATAGATTCTGCTAACACAT

    100     .    :    .    :    .    :    .    :    .    :
     92 TGCTTCAGGCTACTGGGATTCACTTACTGAACACAGTCTAACAAAGCTAG
        ||||||||||||||||||||||||||||||||||||||||||||||| ||
  40825 TGCTTCAGGCTACTGGGATTCACTTACTGAACACAGTCTAACAAAGCAAG

    150     .    :    .    :    .    :    .    :    .    :
    142 CAGTGTTCAAATCTCACCCTCTGGCCAGGACTTATTGAGAAGGAAATGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  40875 CAGTGTTCAAATCTCACCCTCTGGCCAGGACTTATTGAGAAGGAAATGTT

    200     .    :    .    :    .    :    .    :    .    :
    192 CTCTAATATGGCATTTCCACCTTCTGTGTATTTTGCTGTGAGATCTTTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  40925 CTCTAATATGGCATTTCCACCTTCTGTGTATTTTGCTGTGAGATCTTTGA

    250     .    :    .    :    .    :    .    :    .    :
    242 CAGTCATTTGGCCCCCTGAGGGCCAGATGTCATCTTTCTTCACGTGTGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  40975 CAGTCATTTGGCCCCCTGAGGGCCAGATGTCATCTTTCTTCACGTGTGAA

    300     .    :    .    :    .    :    .    :    .    :
    292 TTCTCAATAATCATAACTTTCGAGAGTTGGCCATTCTTGTATGGTTTGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  41025 TTCTCAATAATCATAACTTTCGAGAGTTGGCCATTCTTGTATGGTTTGGT

    350     .    :    .    :    .    :    .    :    .    :
    342 TGACTTGGTAGGTTTACCTTCTGTTGGCATGTCAATGAACTTAAAGACTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  41075 TGACTTGGTAGGTTTACCTTCTGTTGGCATGTCAATGAACTTAAAGACTC

    400     .    :    .    :    .    :    .    :    .    :
    392 GGCTCACAGATCGCAT         CAAGCTATCCACATCTATGCTGGAG
        ||||||||||||||||<<<...<<<|||||||||||||||||||||||||
  41125 GGCTCACAGATCGCATCTG...TACCAAGCTATCCACATCTATGCTGGAG

    450     .    :    .    :    .    :    .    :    .    :
    433 TTTACAGCCCACTGCAATGTACTCATGATATTCATGGCTAAAGTCAGGAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  53974 TTTACAGCCCACTGCAATGTACTCATGATATTCATGGCTAAAGTCAGGAT

    500     .    :    .    :    .
    483 AATACCAACTCTTCCTTCTCCTTCTCCT
        ||||||||||||||||||||||||||||
  54024 AATACCAACTCTTCCTTCTCCTTCTCCT

END