Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AJ300189.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/AJ300189.1, 759 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|13016698|emb|AJ300189.1|HSA300189 Homo sapiens mRNA for CD40 type II isoform (CD40 gene)
>ENSG00000101017

1-79  (50-128)   98% ->
80-158  (3554-3632)   100% ->
159-284  (3967-4092)   100% ->
285-431  (4344-4490)   100% ->
432-525  (4860-4953)   100% ->
526-612  (9872-9958)   100% ->
613-641  (10064-10092)   100% ->
642-759  (10616-10733)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 TGGTCCTGCCGCCTGGTCTCACCTCGCCATGGTTCGTCTGCCTCTGCAGT
        ||||||||||||||||||||||||||| ||||||||||||||||||||||
     50 TGGTCCTGCCGCCTGGTCTCACCTCGCTATGGTTCGTCTGCCTCTGCAGT

     50     .    :    .    :    .    :    .    :    .    :
     51 GCGTCCTCTGGGGCTGCTTGCTGACCGCT         GTCCATCCAGAA
        |||||||||||||||||||||||||||||>>>...>>>||||||||||||
    100 GCGTCCTCTGGGGCTGCTTGCTGACCGCTGTG...TAGGTCCATCCAGAA

    100     .    :    .    :    .    :    .    :    .    :
     92 CCACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3566 CCACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTG

    150     .    :    .    :    .    :    .    :    .    :
    142 TTCTTTGTGCCAGCCAG         GACAGAAACTGGTGAGTGACTGCA
        |||||||||||||||||>>>...>>>||||||||||||||||||||||||
   3616 TTCTTTGTGCCAGCCAGGTG...CAGGACAGAAACTGGTGAGTGACTGCA

    200     .    :    .    :    .    :    .    :    .    :
    183 CAGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3991 CAGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTA

    250     .    :    .    :    .    :    .    :    .    :
    233 GACACCTGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4041 GACACCTGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCC

    300     .    :    .    :    .    :    .    :    .    :
    283 CA         ACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAA
        ||>>>...>>>|||||||||||||||||||||||||||||||||||||||
   4091 CAGTG...CAGACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAA

    350     .    :    .    :    .    :    .    :    .    :
    324 CAGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4383 CAGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCC

    400     .    :    .    :    .    :    .    :    .    :
    374 TGTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4433 TGTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAA

    450     .    :    .    :    .    :    .    :    .    :
    424 GCAGATTG         CTACAGGGGTTTCTGATACCATCTGCGAGCCCT
        ||||||||>>>...>>>|||||||||||||||||||||||||||||||||
   4483 GCAGATTGGTA...CAGCTACAGGGGTTTCTGATACCATCTGCGAGCCCT

    500     .    :    .    :    .    :    .    :    .    :
    465 GCCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4893 GCCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCAC

    550     .    :    .    :    .    :    .    :    .    :
    515 CCTTGGACAAG         GTCCCCAGGATCGGCTGAGAGCCCTGGTGG
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
   4943 CCTTGGACAAGGTA...CAGGTCCCCAGGATCGGCTGAGAGCCCTGGTGG

    600     .    :    .    :    .    :    .    :    .    :
    556 TGATCCCCATCATCTTCGGGATCCTGTTTGCCATCCTCTTGGTGCTGGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   9902 TGATCCCCATCATCTTCGGGATCCTGTTTGCCATCCTCTTGGTGCTGGTC

    650     .    :    .    :    .    :    .    :    .    :
    606 TTTATCA         AAAAGGTGGCCAAGAAGCCAACCAATAAG     
        |||||||>>>...>>>|||||||||||||||||||||||||||||>>>..
   9952 TTTATCAGTG...TAGAAAAGGTGGCCAAGAAGCCAACCAATAAGGTA..

    700     .    :    .    :    .    :    .    :    .    :
    642     GCCCCCCACCCCAAGCAGGAACCCCAGGAGATCAATTTTCCCGACG
        .>>>||||||||||||||||||||||||||||||||||||||||||||||
  10098 .CAGGCCCCCCACCCCAAGCAGGAACCCCAGGAGATCAATTTTCCCGACG

    750     .    :    .    :    .    :    .    :    .    :
    688 ATCTTCCTGGCTCCAACACTGCTGCTCCAGTGCAGGAGACTTTACATGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10662 ATCTTCCTGGCTCCAACACTGCTGCTCCAGTGCAGGAGACTTTACATGGA

    800     .    :    .    :
    738 TGCCAACCGGTCACCCAGGAGG
        ||||||||||||||||||||||
  10712 TGCCAACCGGTCACCCAGGAGG

END