Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AL598563.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AL598563.1, 482 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|15161254|gb|AL598563.1|AL598563 DKFZp313C0721_r1 313 (synonym: hlcc2) Homo sapiens cDNA clone DKFZp313C0721 5', mRNA sequence
>ENSG00000140443

1-92  (241997-242088)   98% ->
93-241  (247208-247356)   99% ->
242-386  (249928-250072)   99% ->
387-482  (259136-259231)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GCCGANAGCAGCGACTCCGAGGGGTTTGTGATCCACGACGGCGAGTGCAT
        ||||| ||||||||||||||||||||||||||||||||||||||||||||
 241997 GCCGAGAGCAGCGACTCCGAGGGGTTTGTGATCCACGACGGCGAGTGCAT

     50     .    :    .    :    .    :    .    :    .    :
     51 GCAGGAGTGCCCCTCGGGCTTCATCCGCAACGGCAGCCAGAG        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
 242047 GCAGGAGTGCCCCTCGGGCTTCATCCGCAACGGCAGCCAGAGGTC...CA

    100     .    :    .    :    .    :    .    :    .    :
     93  CATGTACTGCATCCCTTGTGAAGGTCCTTGCCCGAAGGTCTGTGAGGAA
        >|||||||||||||||||||||||||||||||||||||||||||||||||
 247207 GCATGTACTGCATCCCTTGTGAAGGTCCTTGCCCGAAGGTCTGTGAGGAA

    150     .    :    .    :    .    :    .    :    .    :
    142 GAAAAGAAAACAAAGACCATTGATTCTGTTACTTCTGCTCANATGCTCCA
        ||||||||||||||||||||||||||||||||||||||||| ||||||||
 247257 GAAAAGAAAACAAAGACCATTGATTCTGTTACTTCTGCTCAGATGCTCCA

    200     .    :    .    :    .    :    .    :    .    :
    192 AGGATGCACCATCTTCAAGGGCAATTTGCTCATTAACATCCGACGGGGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 247307 AGGATGCACCATCTTCAAGGGCAATTTGCTCATTAACATCCGACGGGGGA

    250     .    :    .    :    .    :    .    :    .    :
    242          ATAACATTGCTTCAGAGCTGGAGAACTTNATGGGGCTCATC
        >>>...>>>|||||||||||||||||||||||||||| ||||||||||||
 247357 GTA...TAGATAACATTGCTTCAGAGCTGGAGAACTTCATGGGGCTCATC

    300     .    :    .    :    .    :    .    :    .    :
    283 GAGGTGGTGACGGGCTACGTGAAGATCCGCCATTCTCATGCCTTGGTCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 249969 GAGGTGGTGACGGGCTACGTGAAGATCCGCCATTCTCATGCCTTGGTCTC

    350     .    :    .    :    .    :    .    :    .    :
    333 CTTGTCCTTCCTAAAAAACCTTCGCCTCATCCTAGGAGAGGAGCAGCTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 250019 CTTGTCCTTCCTAAAAAACCTTCGCCTCATCCTAGGAGAGGAGCAGCTAG

    400     .    :    .    :    .    :    .    :    .    :
    383 AAGG         GAATTACTCCTTCTACGTCCTCGACAACCAGAACTTG
        ||||>>>...>>>|||||||||||||||||||||||||||||||||||||
 250069 AAGGGTA...TAGGAATTACTCCTTCTACGTCCTCGACAACCAGAACTTG

    450     .    :    .    :    .    :    .    :    .    :
    424 CAGCAACTGTGGGACTGGGACCACCGCAACCTGACCATCAAAGCAGGGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259173 CAGCAACTGTGGGACTGGGACCACCGCAACCTGACCATCAAAGCAGGGAA

    500     .
    474 AATGTACTT
        |||||||||
 259223 AATGTACTT

END