Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AL698709.1
Subject Sequence ID: ENSG00000131828
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/AL698709.1, 473 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000131828 (ENSG00000131828), 15915 bp

>gi|19619249|gb|AL698709.1|AL698709 DKFZp686B2010_r1 686 (synonym: hlcc3) Homo sapiens cDNA clone DKFZp686B2010 5', mRNA sequence
>ENSG00000131828

4-165  (1-162)   99% ->
166-251  (1804-1887)   97% ->
252-311  (5380-5439)   100% ->
312-473  (6005-6166)   100%

      0     .    :    .    :    .    :    .    :    .    :
      4 ACTGAGGCGTGGCGTCTGCTGGGGCACCTGAAGGAGACTTGGGGGCACCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 ACTGAGGCGTGGCGTCTGCTGGGGCACCTGAAGGAGACTTGGGGGCACCC

     50     .    :    .    :    .    :    .    :    .    :
     54 GCGTCGTGCCTCCTGGGTTGTGAGGAGTCGCCGCTGCCGCCACTGCCTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 GCGTCGTGCCTCCTGGGTTGTGAGGAGTCGCCGCTGCCGCCACTGCCTGT

    100     .    :    .    :    .    :    .    :    .    :
    104 GCTTCATGAGGAAGATGCTCGCCGCCGTCTCCCGCGTGCTGTCTGGCGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 GCTTCATGAGGAAGATGCTCGCCGCCGTCTCCCGCGTGCTGTCTGGCGCT

    150     .    :    .    :    .    :    .    :    .    :
    154 TCTCANAAGCCG         TTTGCAGGGTCCCCCCCCCCCCCCGCCAC
        ||||| ||||||>>>...>>>||||||||||-||||||||||||-|||||
    151 TCTCAGAAGCCGGTG...CAGTTTGCAGGGT CCCCCCCCCCCC GCCAC

    200     .    :    .    :    .    :    .    :    .    :
    195 CTTACAGTAGGAAGAAAATTGAGTTCCAGATATGAAGTCACCTTTGAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1831 CTTACAGTAGGAAGAAAATTGAGTTCCAGATATGAAGTCACCTTTGAAAG

    250     .    :    .    :    .    :    .    :    .    :
    245 TGCCCAG         GCAAGCAGAGTGCTGGTAGCATCCCGTAATTTTG
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
   1881 TGCCCAGGTA...AAGGCAAGCAGAGTGCTGGTAGCATCCCGTAATTTTG

    300     .    :    .    :    .    :    .    :    .    :
    286 CAAATGATGCTACATTTGAAATTAAG         AAATGTGACCTTCAC
        ||||||||||||||||||||||||||>>>...>>>|||||||||||||||
   5414 CAAATGATGCTACATTTGAAATTAAGGTA...CAGAAATGTGACCTTCAC

    350     .    :    .    :    .    :    .    :    .    :
    327 CGGCTGGAAGAAGGCCCTCCTGTCACAACAGTGCTCACCAGGGAGGATGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   6020 CGGCTGGAAGAAGGCCCTCCTGTCACAACAGTGCTCACCAGGGAGGATGG

    400     .    :    .    :    .    :    .    :    .    :
    377 GCTCAAATACTACAGGATGATGCAGACTGTACGCCGAATGGAGTTGAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   6070 GCTCAAATACTACAGGATGATGCAGACTGTACGCCGAATGGAGTTGAAAG

    450     .    :    .    :    .    :    .    :    .
    427 CAGATCAGCTGTATAAACAGAAAATTATTCGTGGTTTCTGTCACTTG
        |||||||||||||||||||||||||||||||||||||||||||||||
   6120 CAGATCAGCTGTATAAACAGAAAATTATTCGTGGTTTCTGTCACTTG

END