Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AL701762.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AL701762.1, 571 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|19685118|gb|AL701762.1|AL701762 DKFZp686P24148_r1 686 (synonym: hlcc3) Homo sapiens cDNA clone DKFZp686P24148 5', mRNA sequence
>ENSG00000140443

1-68  (266515-266582)   98% ->
69-273  (267123-267327)   100% ->
274-557  (272599-272882)   99% ->
558-571  (274327-274340)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 CTACATTGTGCGCTGGCAGCGGCAGCCTCAGGACGGCTATCTTTACCGGC
        ||||||||||||||||||||||||||||||||||||||| ||||||||||
 266515 CTACATTGTGCGCTGGCAGCGGCAGCCTCAGGACGGCTACCTTTACCGGC

     50     .    :    .    :    .    :    .    :    .    :
     51 ACAATTACTGCTCCAAAG         ACAAAATCCCCATCAGGAAGTAT
        ||||||||||||||||||>>>...>>>|||||||||||||||||||||||
 266565 ACAATTACTGCTCCAAAGGTA...AAGACAAAATCCCCATCAGGAAGTAT

    100     .    :    .    :    .    :    .    :    .    :
     92 GCCGACGGCACCATCGACATTGAGGAGGTCACAGAGAACCCCAAGACTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267146 GCCGACGGCACCATCGACATTGAGGAGGTCACAGAGAACCCCAAGACTGA

    150     .    :    .    :    .    :    .    :    .    :
    142 GGTGTGTGGTGGGGAGAAAGGGCCTTGCTGCGCCTGCCCCAAAACTGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267196 GGTGTGTGGTGGGGAGAAAGGGCCTTGCTGCGCCTGCCCCAAAACTGAAG

    200     .    :    .    :    .    :    .    :    .    :
    192 CCGAGAAGCAGGCCGAGAAGGAGGAGGCTGAATACCGCAAAGTCTTTGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267246 CCGAGAAGCAGGCCGAGAAGGAGGAGGCTGAATACCGCAAAGTCTTTGAG

    250     .    :    .    :    .    :    .    :    .    :
    242 AATTTCCTGCACAACTCCATCTTCGTGCCCAG         ACCTGAAAG
        ||||||||||||||||||||||||||||||||>>>...>>>|||||||||
 267296 AATTTCCTGCACAACTCCATCTTCGTGCCCAGGTA...CAGACCTGAAAG

    300     .    :    .    :    .    :    .    :    .    :
    283 GAAGCGGAGAGATGTCATGCAAGTGGCCAACACCACCATGTCCAGCCGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272608 GAAGCGGAGAGATGTCATGCAAGTGGCCAACACCACCATGTCCAGCCGAA

    350     .    :    .    :    .    :    .    :    .    :
    333 GCAGGAACACCACGGCCGCAGACACCTACAACATCACTGACCCGGAAGAG
        ||||||||||||||||||||||||||||||||||||| ||||||||||||
 272658 GCAGGAACACCACGGCCGCAGACACCTACAACATCACCGACCCGGAAGAG

    400     .    :    .    :    .    :    .    :    .    :
    383 CTGGAGACAGAGTACCCTTTCTTTGAGAGCAGAGTGGATAACAAGGAGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272708 CTGGAGACAGAGTACCCTTTCTTTGAGAGCAGAGTGGATAACAAGGAGAG

    450     .    :    .    :    .    :    .    :    .    :
    433 AACTGTCATTTCTAACCTTCGGCCTTTCACATTGTACCGCATCGATATCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272758 AACTGTCATTTCTAACCTTCGGCCTTTCACATTGTACCGCATCGATATCC

    500     .    :    .    :    .    :    .    :    .    :
    483 ACAGCTGCAACCACGAGGCTGAGAAGCTGGGCTGCAGCGCCTCCAACTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272808 ACAGCTGCAACCACGAGGCTGAGAAGCTGGGCTGCAGCGCCTCCAACTTC

    550     .    :    .    :    .    :    .    :    .
    533 GTCTTTGCAAGGACTATGCCCGCAG         AAGGAGCAGATGAC
        |||||||||||||||||||||||||>>>...>>>||||||||||||||
 272858 GTCTTTGCAAGGACTATGCCCGCAGGTA...CAGAAGGAGCAGATGAC

END