Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AU077234.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AU077234.1, 107 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|7439858|gb|AU077234.1|AU077234 AU077234 Sugano cDNA library Homo sapiens cDNA clone Zrv62008 similar to 5'-end region of Human CDw40 mRNA for nerve growth factor receptor-related B-lymphocyte activation molecule, mRNA sequence
>ENSG00000101017

1-107  (20-127)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 ANTCAGCAGA GCCTCGCTCGGGCGCCCAGTGGTCCTGCCGCCTGGTCTC
        | ||||||||-|||||||||||||||||||||||||||||||||||||||
     20 AGTCAGCAGAGGCCTCGCTCGGGCGCCCAGTGGTCCTGCCGCCTGGTCTC

     50     .    :    .    :    .    :    .    :    .    :
     50 ACCTCGCCATGGTTCGTCTGCCTCTGCAGTGCGTCCTCTGGGGCTGCTTG
        ||||||| ||||||||||||||||||||||||||||||||||||||||||
     70 ACCTCGCTATGGTTCGTCTGCCTCTGCAGTGCGTCCTCTGGGGCTGCTTG

    100     .
    100 CTGACCGC
        ||||||||
    120 CTGACCGC

END