Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AU100242.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AU100242.1, 300 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|13551371|gb|AU100242.1|AU100242 AU100242 Sugano Homo sapiens cDNA library Homo sapiens cDNA clone Zrv62008 similar to Human CDw40 mRNA for nerve growth factor receptor-related B-lymphocyte activation molecule, mRNA sequence
>ENSG00000101017

1-108  (20-128)   96% ->
109-187  (3554-3632)   100% ->
188-300  (3967-4079)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 ANTCAGCAGA GCCTCGCTCGGGCGCCCAGTGGTCCTGCCGCCTGGTCTC
        | ||||||||-|||||||||||||||||||||||||||||||||||||||
     20 AGTCAGCAGAGGCCTCGCTCGGGCGCCCAGTGGTCCTGCCGCCTGGTCTC

     50     .    :    .    :    .    :    .    :    .    :
     50 ANCTCGCCATGGTTCGTCTGCCTCTGCAGTGCGTCCTCTGGGGCTGCTTG
        | ||||| ||||||||||||||||||||||||||||||||||||||||||
     70 ACCTCGCTATGGTTCGTCTGCCTCTGCAGTGCGTCCTCTGGGGCTGCTTG

    100     .    :    .    :    .    :    .    :    .    :
    100 CTGACCGCT         GTCCATCCAGAACCACCCACTGCATGCAGAGA
        |||||||||>>>...>>>||||||||||||||||||||||||||||||||
    120 CTGACCGCTGTG...TAGGTCCATCCAGAACCACCCACTGCATGCAGAGA

    150     .    :    .    :    .    :    .    :    .    :
    141 AAAACAGTACCTAATAAACAGTCAGTGCTGTTCTTTGTGCCAGCCAG   
        |||||||||||||||||||||||||||||||||||||||||||||||>>>
   3586 AAAACAGTACCTAATAAACAGTCAGTGCTGTTCTTTGTGCCAGCCAGGTG

    200     .    :    .    :    .    :    .    :    .    :
    188       GACAGAAACTGGTGAGTGACTGCACAGAGTTCACTGAAACGGAA
        ...>>>||||||||||||||||||||||||||||||||||||||||||||
   3636 ...CAGGACAGAAACTGGTGAGTGACTGCACAGAGTTCACTGAAACGGAA

    250     .    :    .    :    .    :    .    :    .    :
    232 TGCCTTCCTTGCGGTGAAAGCGAATTCCTAGACACCTGGAACAGGGATAC
        |||||||||||||||||||||||||||||||||||||||||||| || ||
   4011 TGCCTTCCTTGCGGTGAAAGCGAATTCCTAGACACCTGGAACAGAGAGAC

    300     .    :    .
    282 ACACTGCCACCAGCACAAA
        |||||||||||||||||||
   4061 ACACTGCCACCAGCACAAA

END