Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AV658964.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AV658964.1, 410 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|9879978|gb|AV658964.1|AV658964 AV658964 GLC Homo sapiens cDNA clone GLCFSA05 3', mRNA sequence
>ENSG00000001626

1-410  (187414-187818)   94%

      0     .    :    .    :    .    :    .    :    .    :
      1 ATTTTCCTGAGAACCCTCGCCATGTGCTAGTAATTGGAAAGGCAGCTCTA
        |||||||||| |||||| ||||||||||||||||||||||||||||||||
 187414 ATTTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTA

     50     .    :    .    :    .    :    .    :    .    :
     51 AATGTGAATCAGCCTAATTGATCAGCTTATTGTCTAGTGAAACTCGTTAA
        ||||| |||||||||| |||||||||||||||||||||||||||||||||
 187464 AATGTCAATCAGCCTAGTTGATCAGCTTATTGTCTAGTGAAACTCGTTAA

    100     .    :    .    :    .    :    .    :    .    :
    101 TTTGTAGTGTGTGGAGAAGAACTGAAATCATACTTCTTAAGGGTATGATT
        ||||||||||-|||||||||||||||||||||||||||| || |||||||
 187514 TTTGTAGTGT TGGAGAAGAACTGAAATCATACTTCTTAGGGTTATGATT

    150     .    :    .    :    .    :    .    :    .    :
    151 AAGTAATGAGTAACTGGAAACTTCAGCGGGTTATATAAGCTTGGATTCCT
        |||||||||-||||||||||||||||||| ||||||||||||| ||||||
 187563 AAGTAATGA TAACTGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCT

    200     .    :    .    :    .    :    .    :    .    :
    201 TTTTCTCTCCTCTCCCCATGAAGTGTTAGAAACACAACTATATTGGTTGC
        ||||||||||||||||||||| ||-|||||||||||||||||||| ||||
 187612 TTTTCTCTCCTCTCCCCATGATGT TTAGAAACACAACTATATTGTTTGC

    250     .    :    .    :    .    :    .    :    .    :
    251 GTATAGCATTCCAACTATCTCATTTCCAAGCAAGTGTTAGAATACCACAG
        -||-||||||||||||||||||||||||||||||| ||||||||||||||
 187661  TA AGCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATACCACAG

    300     .    :    .    :    .    :    .    :    .    :
    301 GAACCACAAGACTGCGCATCAAAATATGCCCCATTCAACATCTATTGAGC
        ||||||||||||||| |||||||||||||||||||||||||||| |||||
 187709 GAACCACAAGACTGCACATCAAAATATGCCCCATTCAACATCTAGTGAGC

    350     .    :    .    :    .    :    .    :    .    :
    351 AGTCAGGAAAGAGAACTTCCAGATCCTGGAAATCAAGGTTAGTATTGTGC
        ||||||||||||||||||||||||||||||||||| |||||||||||| |
 187759 AGTCAGGAAAGAGAACTTCCAGATCCTGGAAATCAGGGTTAGTATTGTCC

    400     .    :
    401 AAGTCTACCA
        | ||||||||
 187809 AGGTCTACCA

END