Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AV720046.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AV720046.1, 589 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|10817198|gb|AV720046.1|AV720046 AV720046 GLC Homo sapiens cDNA clone GLCEKG06 5', mRNA sequence
>ENSG00000017427

1-589  (21-608)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 GATAAAAGATCAACAGCAATCTACCAACTCCAGGACCATTTTTGCACGGT
        |||||||||||||||||||||||||||||||||||||||||||||| |||
     21 GATAAAAGATCAACAGCAATCTACCAACTCCAGGACCATTTTTGCAAGGT

     50     .    :    .    :    .    :    .    :    .    :
     51 GCAAATCACTCCTAAAGACAATGTTGGAATGTTTACTTGTGTATTTCATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     71 GCAAATCACTCCTAAAGACAATGTTGGAATGTTTACTTGTGTATTTCATT

    100     .    :    .    :    .    :    .    :    .    :
    101 GGGGGAAACGCCCATCTTTTAAATGTTATCAAACTTATTTTTTGGTAGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    121 GGGGGAAACGCCCATCTTTTAAATGTTATCAAACTTATTTTTTGGTAGGT

    150     .    :    .    :    .    :    .    :    .    :
    151 GTTCCAAAGTTTAACAGGTAACTCGTGCAGAGCAAAGGATCCTGCGGTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    171 GTTCCAAAGTTTAACAGGTAACTCGTGCAGAGCAAAGGATCCTGCGGTGG

    200     .    :    .    :    .    :    .    :    .    :
    201 CATGTCACTCTTCACTCCTCAGGAGGGTCTTCCTACATCCTGTAGTTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    221 CATGTCACTCTTCACTCCTCAGGAGGGTCTTCCTACATCCTGTAGTTCTT

    250     .    :    .    :    .    :    .    :    .    :
    251 GTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAATGTACTTCCTATAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    271 GTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAATGTACTTCCTATAAAT

    300     .    :    .    :    .    :    .    :    .    :
    301 AAAGGAGAAAAAGTGACATTAACTTGATGAAGTTTTATGTATCCATCTAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    321 AAAGGAGAAAAAGTGACATTAACTTGATGAAGTTTTATGTATCCATCTAT

    350     .    :    .    :    .    :    .    :    .    :
    351 TTCTAACATTGGGCCTCAACCTTCCATGTCTTACGCCTTACCAGTTGAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    371 TTCTAACATTGGGCCTCAACCTTCCATGTCTTACGCCTTACCAGTTGAGC

    400     .    :    .    :    .    :    .    :    .    :
    401 TAATAGAGAGCTTGAACCTTGGTTTTCCTGACAAGGGCATGTATAGGTGG
        ||||||||||||||||||||||||||||||| ||||||||||||||||||
    421 TAATAGAGAGCTTGAACCTTGGTTTTCCTGAGAAGGGCATGTATAGGTGG

    450     .    :    .    :    .    :    .    :    .    :
    451 ACAGGCCCTTAATACTTTTTCCAAACCTCACTCAGGCATGTTCTATGTAC
        ||||||||||| ||||||| ||||||||||||||||||| ||||||||||
    471 ACAGGCCCTTAGTACTTTTGCCAAACCTCACTCAGGCATCTTCTATGTAC

    500     .    :    .    :    .    :    .    :    .    :
    501 CCCTGGTGGCGTGAATACCACAGACAGCTTTATTATCACACAAAGATGAA
        ||||||||||||||||||||||||||||||||| ||||||||||||||| 
    521 CCCTGGTGGCGTGAATACCACAGACAGCTTTATAATCACACAAAGATGAG

    550     .    :    .    :    .    :    .
    551 ATTTGATTCATCTGCTTGTATCACAGATTCATCTGATGG
        ||||||||||||||||| ||||||||||||||-|||| |
    571 ATTTGATTCATCTGCTTCTATCACAGATTCAT TGATTG

END