Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AV723799.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AV723799.1, 574 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|10827558|gb|AV723799.1|AV723799 AV723799 HTB Homo sapiens cDNA clone HTBAQC11 5', mRNA sequence
>ENSG00000017427

1-160  (2973-3133)   83%

      0     .    :    .    :    .    :    .    :    .    :
      1 CAGGCACCCACCA CTATGCCCGGCTAATTTTTTGGATTTTTAATAGAGA
        ||||||| | |||-|-|||||| |||||||||||| ||||||||||||||
   2973 CAGGCACGCGCCATC ATGCCCAGCTAATTTTTTGTATTTTTAATAGAGA

     50     .    :    .    :    .    :    .    :    .    :
     50 CGGGGTTTTACCATGTTGGCCAGATTGGTCTCAAACTCCTGACCT  TGT
          |||||| ||||||||||||||  ||||||  ||||||||||||-- ||
   3022 TAGGGTTTCACCATGTTGGCCAGGCTGGTCTTGAACTCCTGACCTCAGGT

    100     .    :    .    :    .    :    .    :    .    :
     98 GATTTGCCCACCTCAGCCTCCCAAATTGCTGGGATTACAGGCATGAGCCA
        ||| ||||  |||||||||||  || ||||||||||||||||||||||||
   3072 GATCTGCCTGCCTCAGCCTCCTGAAGTGCTGGGATTACAGGCATGAGCCA

    150     .    :
    148 CCACACCCTGCCC
         ||  -|||| ||
   3122 TCATG CCTGGCC

END