Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AV734487.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AV734487.1, 584 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|10852032|gb|AV734487.1|AV734487 AV734487 cdA Homo sapiens cDNA clone cdAAVD02 5', mRNA sequence
>ENSG00000017427

(complement)

329-385  (24266-24324)   91% ==
446-466  (27225-27244)   90%

      0     .    :    .    :    .    :    .    :    .    :
    329 CTACA TACAC AGACACACACACACACACACACACACACACACACACAC
        ||| |-|| ||-| ||||||||||||||||||||||||||||||||||||
  24266 CTAGATTAGACAATACACACACACACACACACACACACACACACACACAC

     50     .
    377 ACACACACA
        |||||||||
  24316 ACACACACA

      0     .    :    .    :
    446 AAAACAAACAAACAAACAGCC
        |||||||||||||||| -|||
  27225 AAAACAAACAAACAAAT GCC

END