Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: AW102819.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/AW102819.1, 155 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|6073432|gb|AW102819.1|AW102819 xd38f05.x1 NCI_CGAP_Ov23 Homo sapiens cDNA clone IMAGE:2596065 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

(complement)

30-56  (2222-2248)   85%

      0     .    :    .    :    .
     30 TTTTTTTTCTTTTTTTCTTTTTTTTTT
        ||||||||||||||||||  | | |||
   2222 TTTTTTTTCTTTTTTTCTCATGTCTTT

END